| Variant ID: vg0620513238 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 20513238 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
CCGATGGCCTGAAAGATTCTGACCAGGAGCAATAGAGAAGTACGATGGGAGCACCGACCTAGAAGAATTCCTTCAGGTTTACTCCATGGTACTCTATGCT[T/G]
CCGGAGGGGACGACAACGCATTGGCGAATTACTTGCCAACTGCATTGAAAGGCTCTGCGCGTTCATGGCTGATGCACCTTCCCCCTACTCGATTTCTTCG
CGAAGAAATCGAGTAGGGGGAAGGTGCATCAGCCATGAACGCGCAGAGCCTTTCAATGCAGTTGGCAAGTAATTCGCCAATGCGTTGTCGTCCCCTCCGG[A/C]
AGCATAGAGTACCATGGAGTAAACCTGAAGGAATTCTTCTAGGTCGGTGCTCCCATCGTACTTCTCTATTGCTCCTGGTCAGAATCTTTCAGGCCATCGG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 32.90% | 1.60% | 7.11% | 58.42% | NA |
| All Indica | 2759 | 7.30% | 0.00% | 6.89% | 85.76% | NA |
| All Japonica | 1512 | 85.30% | 4.60% | 0.93% | 9.26% | NA |
| Aus | 269 | 0.40% | 0.00% | 33.83% | 65.80% | NA |
| Indica I | 595 | 7.10% | 0.00% | 1.85% | 91.09% | NA |
| Indica II | 465 | 10.10% | 0.00% | 13.12% | 76.77% | NA |
| Indica III | 913 | 4.70% | 0.00% | 6.68% | 88.61% | NA |
| Indica Intermediate | 786 | 8.90% | 0.10% | 7.25% | 83.72% | NA |
| Temperate Japonica | 767 | 91.10% | 5.10% | 0.13% | 3.65% | NA |
| Tropical Japonica | 504 | 91.10% | 0.00% | 2.38% | 6.55% | NA |
| Japonica Intermediate | 241 | 54.40% | 12.40% | 0.41% | 32.78% | NA |
| VI/Aromatic | 96 | 20.80% | 1.00% | 36.46% | 41.67% | NA |
| Intermediate | 90 | 45.60% | 5.60% | 6.67% | 42.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0620513238 | T -> G | LOC_Os06g35190.1 | downstream_gene_variant ; 3421.0bp to feature; MODIFIER | silent_mutation | Average:14.772; most accessible tissue: Callus, score: 39.351 | N | N | N | N |
| vg0620513238 | T -> G | LOC_Os06g35180.1 | intron_variant ; MODIFIER | silent_mutation | Average:14.772; most accessible tissue: Callus, score: 39.351 | N | N | N | N |
| vg0620513238 | T -> DEL | N | N | silent_mutation | Average:14.772; most accessible tissue: Callus, score: 39.351 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0620513238 | 1.54E-06 | 1.54E-06 | mr1024_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620513238 | NA | 6.79E-06 | mr1167_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620513238 | 1.54E-07 | 1.54E-07 | mr1367_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620513238 | 3.24E-06 | 6.29E-06 | mr1698_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620513238 | NA | 1.92E-06 | mr1726_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620513238 | NA | 1.44E-06 | mr1781_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620513238 | 6.58E-06 | 6.58E-06 | mr1806_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620513238 | NA | 4.08E-08 | mr1827_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620513238 | 3.75E-06 | 3.75E-06 | mr1914_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |