\
| Variant ID: vg0620513077 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 20513077 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
CGTCCTCGTAATCGCACGCCGGAACCAAGCGACCCATCGTCATCGTCGTCATCTTCCTCATCCTTATCATCAGATAGACATCCGCGAAGGATGTACGATC[A/G]
CCGACAACCCACCGCCCCCAGCGCTGGGTGTAGAGCTTTCGGTCGTTCACTTCGAGATGTCCGATGGCCTGAAAGATTCTGACCAGGAGCAATAGAGAAG
CTTCTCTATTGCTCCTGGTCAGAATCTTTCAGGCCATCGGACATCTCGAAGTGAACGACCGAAAGCTCTACACCCAGCGCTGGGGGCGGTGGGTTGTCGG[T/C]
GATCGTACATCCTTCGCGGATGTCTATCTGATGATAAGGATGAGGAAGATGACGACGATGACGATGGGTCGCTTGGTTCCGGCGTGCGATTACGAGGACG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 32.60% | 1.60% | 7.34% | 58.44% | NA |
| All Indica | 2759 | 6.90% | 0.00% | 7.39% | 85.65% | NA |
| All Japonica | 1512 | 85.30% | 4.60% | 1.06% | 9.13% | NA |
| Aus | 269 | 0.70% | 0.00% | 36.06% | 63.20% | NA |
| Indica I | 595 | 6.70% | 0.00% | 2.35% | 90.92% | NA |
| Indica II | 465 | 10.50% | 0.00% | 13.76% | 75.70% | NA |
| Indica III | 913 | 3.90% | 0.00% | 6.68% | 89.38% | NA |
| Indica Intermediate | 786 | 8.40% | 0.10% | 8.27% | 83.21% | NA |
| Temperate Japonica | 767 | 91.10% | 5.10% | 0.00% | 3.78% | NA |
| Tropical Japonica | 504 | 91.10% | 0.00% | 2.98% | 5.95% | NA |
| Japonica Intermediate | 241 | 54.40% | 12.40% | 0.41% | 32.78% | NA |
| VI/Aromatic | 96 | 17.70% | 1.00% | 26.04% | 55.21% | NA |
| Intermediate | 90 | 46.70% | 5.60% | 5.56% | 42.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0620513077 | A -> G | LOC_Os06g35190.1 | downstream_gene_variant ; 3582.0bp to feature; MODIFIER | silent_mutation | Average:14.629; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| vg0620513077 | A -> G | LOC_Os06g35180.1 | intron_variant ; MODIFIER | silent_mutation | Average:14.629; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| vg0620513077 | A -> DEL | N | N | silent_mutation | Average:14.629; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0620513077 | NA | 2.49E-06 | mr1057 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620513077 | NA | 3.63E-07 | mr1415 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620513077 | NA | 3.63E-07 | mr1567 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620513077 | NA | 9.17E-06 | mr1006_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620513077 | NA | 2.44E-06 | mr1037_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620513077 | 5.94E-07 | 9.96E-08 | mr1622_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620513077 | NA | 5.96E-06 | mr1827_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |