\
| Variant ID: vg0620496522 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 20496522 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.67, A: 0.33, others allele: 0.00, population size: 49. )
ATGTACCAAAATATTATTATCAGTAGACCCCAGAAAGGTCACACTACAATTTTGATTTATCAAGTGCATGACCCTTGATAAATTTACTCATGTGTGTGAT[G/A]
TCCGTGACTGCTTCCCGAAGCACCAACCAATTTTATTTTGAGGAAAACATCAACTAACTATGTATCACCTAAGAGGGTAATATTCAGAACTTGTGATCTT
AAGATCACAAGTTCTGAATATTACCCTCTTAGGTGATACATAGTTAGTTGATGTTTTCCTCAAAATAAAATTGGTTGGTGCTTCGGGAAGCAGTCACGGA[C/T]
ATCACACACATGAGTAAATTTATCAAGGGTCATGCACTTGATAAATCAAAATTGTAGTGTGACCTTTCTGGGGTCTACTGATAATAATATTTTGGTACAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.50% | 41.50% | 1.42% | 3.51% | NA |
| All Indica | 2759 | 31.10% | 66.30% | 2.28% | 0.33% | NA |
| All Japonica | 1512 | 87.00% | 6.20% | 0.13% | 6.75% | NA |
| Aus | 269 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 5.50% | 94.10% | 0.34% | 0.00% | NA |
| Indica II | 465 | 34.60% | 63.20% | 1.94% | 0.22% | NA |
| Indica III | 913 | 44.40% | 50.30% | 4.93% | 0.44% | NA |
| Indica Intermediate | 786 | 32.80% | 65.80% | 0.89% | 0.51% | NA |
| Temperate Japonica | 767 | 91.00% | 7.00% | 0.00% | 1.96% | NA |
| Tropical Japonica | 504 | 96.80% | 0.80% | 0.20% | 2.18% | NA |
| Japonica Intermediate | 241 | 53.50% | 14.50% | 0.41% | 31.54% | NA |
| VI/Aromatic | 96 | 42.70% | 7.30% | 1.04% | 48.96% | NA |
| Intermediate | 90 | 56.70% | 33.30% | 1.11% | 8.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0620496522 | G -> A | LOC_Os06g35160.1 | upstream_gene_variant ; 4248.0bp to feature; MODIFIER | silent_mutation | Average:22.214; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| vg0620496522 | G -> A | LOC_Os06g35165.1 | upstream_gene_variant ; 697.0bp to feature; MODIFIER | silent_mutation | Average:22.214; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| vg0620496522 | G -> A | LOC_Os06g35160-LOC_Os06g35165 | intergenic_region ; MODIFIER | silent_mutation | Average:22.214; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| vg0620496522 | G -> DEL | N | N | silent_mutation | Average:22.214; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0620496522 | NA | 2.41E-11 | mr1609 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620496522 | 2.52E-07 | 2.76E-07 | mr1037_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620496522 | 9.48E-07 | 9.43E-08 | mr1062_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620496522 | NA | 3.78E-06 | mr1167_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620496522 | NA | 1.01E-06 | mr1291_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620496522 | NA | 1.61E-06 | mr1726_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620496522 | NA | 5.19E-08 | mr1827_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |