\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0620489670:

Variant ID: vg0620489670 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 20489670
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATAACACTTTAGTAATTTTTGGTTCAGATTGAATCTAATTGAGAGTACCCGGTGCTAAACCTTATCGTGCACTAGGGGAGAAGCATCCTGAGCGCCATTG[T/C]
TGACAAAGCACGTGACAATAGCACGGTTTGATGATAGAATAACAAAGAAAAGACAAAATTACTCTTTCAAACTTTATACTGTCATCTAATTAACTAAAAA

Reverse complement sequence

TTTTTAGTTAATTAGATGACAGTATAAAGTTTGAAAGAGTAATTTTGTCTTTTCTTTGTTATTCTATCATCAAACCGTGCTATTGTCACGTGCTTTGTCA[A/G]
CAATGGCGCTCAGGATGCTTCTCCCCTAGTGCACGATAAGGTTTAGCACCGGGTACTCTCAATTAGATTCAATCTGAACCAAAAATTACTAAAGTGTTAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.30% 1.50% 2.16% 1.04% NA
All Indica  2759 99.70% 0.00% 0.18% 0.11% NA
All Japonica  1512 89.40% 4.50% 3.17% 2.98% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.00% 0.00% 0.22% NA
Indica III  913 99.60% 0.00% 0.33% 0.11% NA
Indica Intermediate  786 99.60% 0.00% 0.25% 0.13% NA
Temperate Japonica  767 94.00% 5.00% 0.26% 0.78% NA
Tropical Japonica  504 98.20% 0.00% 0.79% 0.99% NA
Japonica Intermediate  241 56.00% 12.40% 17.43% 14.11% NA
VI/Aromatic  96 54.20% 1.00% 44.79% 0.00% NA
Intermediate  90 88.90% 3.30% 6.67% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0620489670 T -> C LOC_Os06g35160.1 downstream_gene_variant ; 525.0bp to feature; MODIFIER silent_mutation Average:69.045; most accessible tissue: Minghui63 flag leaf, score: 93.043 N N N N
vg0620489670 T -> C LOC_Os06g35150-LOC_Os06g35160 intergenic_region ; MODIFIER silent_mutation Average:69.045; most accessible tissue: Minghui63 flag leaf, score: 93.043 N N N N
vg0620489670 T -> DEL N N silent_mutation Average:69.045; most accessible tissue: Minghui63 flag leaf, score: 93.043 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0620489670 T C 0.03 0.02 0.02 0.03 0.03 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0620489670 NA 2.86E-06 Grain_weight Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0620489670 2.89E-07 2.89E-07 mr1024_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620489670 1.73E-06 6.84E-07 mr1037_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620489670 2.00E-06 2.00E-06 mr1367_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620489670 2.57E-06 1.04E-07 mr1565_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620489670 1.89E-06 1.89E-06 mr1806_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620489670 NA 2.86E-06 mr1827_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620489670 2.19E-06 2.19E-06 mr1914_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620489670 6.35E-06 6.35E-06 mr1915_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251