Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0620448711:

Variant ID: vg0620448711 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 20448711
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CACTCTCCCCCTTCCGTCGGCGCCCCTCTCCCTCCCCCCTCCCCCTTCCACCGGCGCCCCTCTTCCCCCCCTTCTGCCGGCACCCCTCTCTGCCCCTAAG[A/G]
GTTATCACAACCGGCGTGGAGCGGGACAGCGCAAAGCTCACCAGTGTGGAGTAGGATGGCGTGGAACTCGTCGGCATGGATCTGGTGGTAGATGACCTCG

Reverse complement sequence

CGAGGTCATCTACCACCAGATCCATGCCGACGAGTTCCACGCCATCCTACTCCACACTGGTGAGCTTTGCGCTGTCCCGCTCCACGCCGGTTGTGATAAC[T/C]
CTTAGGGGCAGAGAGGGGTGCCGGCAGAAGGGGGGGAAGAGGGGCGCCGGTGGAAGGGGGAGGGGGGAGGGAGAGGGGCGCCGACGGAAGGGGGAGAGTG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.50%	28.50%	1.99%	0.04%	NA
All Indica	2759	98.70%	1.20%	0.07%	0.00%	NA
All Japonica	1512	9.10%	84.70%	6.02%	0.13%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.50%	0.50%	0.00%	0.00%	NA
Indica II	465	97.20%	2.80%	0.00%	0.00%	NA
Indica III	913	99.70%	0.20%	0.11%	0.00%	NA
Indica Intermediate	786	97.80%	2.00%	0.13%	0.00%	NA
Temperate Japonica	767	8.00%	91.00%	1.04%	0.00%	NA
Tropical Japonica	504	7.10%	90.90%	1.98%	0.00%	NA
Japonica Intermediate	241	17.00%	51.90%	30.29%	0.83%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	65.60%	33.30%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0620448711	A -> G	LOC_Os06g35130.1	upstream_gene_variant ; 4644.0bp to feature; MODIFIER	silent_mutation	Average:71.523; most accessible tissue: Zhenshan97 panicle, score: 80.486	N	N	N	N
vg0620448711	A -> G	LOC_Os06g35130-LOC_Os06g35140	intergenic_region ; MODIFIER	silent_mutation	Average:71.523; most accessible tissue: Zhenshan97 panicle, score: 80.486	N	N	N	N
vg0620448711	A -> DEL	N	N	silent_mutation	Average:71.523; most accessible tissue: Zhenshan97 panicle, score: 80.486	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0620448711	5.01E-07	1.09E-57	mr1103	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620448711	NA	1.04E-30	mr1107	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620448711	1.88E-06	9.81E-90	mr1140	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620448711	8.81E-07	NA	mr1203	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620448711	NA	7.83E-12	mr1233	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620448711	NA	5.48E-27	mr1309	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620448711	NA	2.24E-07	mr1354	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620448711	2.37E-06	NA	mr1395	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620448711	NA	8.23E-07	mr1408	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620448711	NA	2.67E-25	mr1411	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620448711	NA	1.17E-18	mr1518	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620448711	8.78E-07	NA	mr1618	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620448711	NA	9.33E-20	mr1676	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620448711	NA	4.62E-09	mr1806	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620448711	NA	5.38E-15	mr1949	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620448711	NA	1.64E-12	mr1097_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620448711	NA	2.74E-16	mr1114_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620448711	NA	3.05E-15	mr1148_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620448711	4.18E-06	7.14E-19	mr1165_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620448711	8.17E-07	NA	mr1165_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620448711	NA	1.79E-23	mr1242_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620448711	NA	2.80E-09	mr1506_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620448711	NA	1.49E-08	mr1660_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620448711	NA	9.07E-11	mr1714_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620448711	NA	1.59E-14	mr1726_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620448711	NA	3.28E-11	mr1781_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620448711	NA	5.34E-14	mr1806_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620448711	NA	6.48E-18	mr1817_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620448711	NA	2.08E-23	mr1949_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251