\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0620427074:

Variant ID: vg0620427074 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 20427074
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.02, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


CTCTTTCAATCTTGGGAAGTCTGGAAATCAAAGAGGAAGTTTAGTCCGGGTCGGTTTCCTTGGGATGCAAAAGGGATATTTCCAATCTCGTTTGATCTCC[G/A]
CTATAAAGTTGTGGTATTCGGCAGGCCAGTAATACAATACAAAGTTCTCCAAGGTTTTCCCCTCCTGGTTGCAATTTAGGGTTTCTACCTCATAAGCTCA

Reverse complement sequence

TGAGCTTATGAGGTAGAAACCCTAAATTGCAACCAGGAGGGGAAAACCTTGGAGAACTTTGTATTGTATTACTGGCCTGCCGAATACCACAACTTTATAG[C/T]
GGAGATCAAACGAGATTGGAAATATCCCTTTTGCATCCCAAGGAAACCGACCCGGACTAAACTTCCTCTTTGATTTCCAGACTTCCCAAGATTGAAAGAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.10% 10.90% 0.00% 0.00% NA
All Indica  2759 96.40% 3.60% 0.00% 0.00% NA
All Japonica  1512 93.40% 6.60% 0.00% 0.00% NA
Aus  269 2.60% 97.40% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 97.40% 2.60% 0.00% 0.00% NA
Indica III  913 95.20% 4.80% 0.00% 0.00% NA
Indica Intermediate  786 94.40% 5.60% 0.00% 0.00% NA
Temperate Japonica  767 95.00% 5.00% 0.00% 0.00% NA
Tropical Japonica  504 93.80% 6.20% 0.00% 0.00% NA
Japonica Intermediate  241 87.10% 12.90% 0.00% 0.00% NA
VI/Aromatic  96 57.30% 42.70% 0.00% 0.00% NA
Intermediate  90 88.90% 11.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0620427074 G -> A LOC_Os06g35090.1 upstream_gene_variant ; 3409.0bp to feature; MODIFIER silent_mutation Average:55.241; most accessible tissue: Zhenshan97 young leaf, score: 73.923 N N N N
vg0620427074 G -> A LOC_Os06g35100.1 upstream_gene_variant ; 112.0bp to feature; MODIFIER silent_mutation Average:55.241; most accessible tissue: Zhenshan97 young leaf, score: 73.923 N N N N
vg0620427074 G -> A LOC_Os06g35110.1 downstream_gene_variant ; 1765.0bp to feature; MODIFIER silent_mutation Average:55.241; most accessible tissue: Zhenshan97 young leaf, score: 73.923 N N N N
vg0620427074 G -> A LOC_Os06g35090-LOC_Os06g35100 intergenic_region ; MODIFIER silent_mutation Average:55.241; most accessible tissue: Zhenshan97 young leaf, score: 73.923 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0620427074 NA 1.33E-06 mr1126 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620427074 NA 2.28E-07 mr1415 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620427074 NA 2.28E-07 mr1567 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620427074 9.97E-07 NA mr1037_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620427074 5.49E-07 1.17E-07 mr1037_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620427074 NA 4.11E-09 mr1126_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620427074 NA 5.66E-06 mr1167_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620427074 NA 4.98E-06 mr1291_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620427074 NA 1.53E-08 mr1522_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620427074 NA 4.57E-07 mr1567_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620427074 NA 1.36E-07 mr1612_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620427074 NA 3.00E-06 mr1726_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620427074 NA 7.08E-07 mr1827_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620427074 NA 1.17E-15 mr1911_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620427074 NA 4.66E-08 mr1929_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251