\
| Variant ID: vg0620427074 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 20427074 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.02, others allele: 0.00, population size: 232. )
CTCTTTCAATCTTGGGAAGTCTGGAAATCAAAGAGGAAGTTTAGTCCGGGTCGGTTTCCTTGGGATGCAAAAGGGATATTTCCAATCTCGTTTGATCTCC[G/A]
CTATAAAGTTGTGGTATTCGGCAGGCCAGTAATACAATACAAAGTTCTCCAAGGTTTTCCCCTCCTGGTTGCAATTTAGGGTTTCTACCTCATAAGCTCA
TGAGCTTATGAGGTAGAAACCCTAAATTGCAACCAGGAGGGGAAAACCTTGGAGAACTTTGTATTGTATTACTGGCCTGCCGAATACCACAACTTTATAG[C/T]
GGAGATCAAACGAGATTGGAAATATCCCTTTTGCATCCCAAGGAAACCGACCCGGACTAAACTTCCTCTTTGATTTCCAGACTTCCCAAGATTGAAAGAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.10% | 10.90% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 96.40% | 3.60% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 93.40% | 6.60% | 0.00% | 0.00% | NA |
| Aus | 269 | 2.60% | 97.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 95.20% | 4.80% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 95.00% | 5.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 87.10% | 12.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 57.30% | 42.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 88.90% | 11.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0620427074 | G -> A | LOC_Os06g35090.1 | upstream_gene_variant ; 3409.0bp to feature; MODIFIER | silent_mutation | Average:55.241; most accessible tissue: Zhenshan97 young leaf, score: 73.923 | N | N | N | N |
| vg0620427074 | G -> A | LOC_Os06g35100.1 | upstream_gene_variant ; 112.0bp to feature; MODIFIER | silent_mutation | Average:55.241; most accessible tissue: Zhenshan97 young leaf, score: 73.923 | N | N | N | N |
| vg0620427074 | G -> A | LOC_Os06g35110.1 | downstream_gene_variant ; 1765.0bp to feature; MODIFIER | silent_mutation | Average:55.241; most accessible tissue: Zhenshan97 young leaf, score: 73.923 | N | N | N | N |
| vg0620427074 | G -> A | LOC_Os06g35090-LOC_Os06g35100 | intergenic_region ; MODIFIER | silent_mutation | Average:55.241; most accessible tissue: Zhenshan97 young leaf, score: 73.923 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0620427074 | NA | 1.33E-06 | mr1126 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620427074 | NA | 2.28E-07 | mr1415 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620427074 | NA | 2.28E-07 | mr1567 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620427074 | 9.97E-07 | NA | mr1037_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620427074 | 5.49E-07 | 1.17E-07 | mr1037_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620427074 | NA | 4.11E-09 | mr1126_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620427074 | NA | 5.66E-06 | mr1167_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620427074 | NA | 4.98E-06 | mr1291_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620427074 | NA | 1.53E-08 | mr1522_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620427074 | NA | 4.57E-07 | mr1567_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620427074 | NA | 1.36E-07 | mr1612_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620427074 | NA | 3.00E-06 | mr1726_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620427074 | NA | 7.08E-07 | mr1827_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620427074 | NA | 1.17E-15 | mr1911_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620427074 | NA | 4.66E-08 | mr1929_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |