Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0620424954:

Variant ID: vg0620424954 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 20424954
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.74, A: 0.25, others allele: 0.00, population size: 186. )

Flanking Sequence (100 bp) in Reference Genome:

GAGGATTTTCTAGTGAGAAACAGACTTTAATCCTAATGCAATACTTCATGCACTAGCAACCCGCTGTTCCCAGATGTCGCTCTACTACGTACCCGGACAG[G/A]
GAGGACTTGGGTGATCTTGAGGCCTGTCACCACCTCTATACCTACCTCAAACACATACTGTGGGATACGCAGCAATTACTGGATAACAATTGACTAAACA

Reverse complement sequence

TGTTTAGTCAATTGTTATCCAGTAATTGCTGCGTATCCCACAGTATGTGTTTGAGGTAGGTATAGAGGTGGTGACAGGCCTCAAGATCACCCAAGTCCTC[C/T]
CTGTCCGGGTACGTAGTAGAGCGACATCTGGGAACAGCGGGTTGCTAGTGCATGAAGTATTGCATTAGGATTAAAGTCTGTTTCTCACTAGAAAATCCTC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.90%	31.80%	0.30%	0.00%	NA
All Indica	2759	97.40%	2.60%	0.00%	0.00%	NA
All Japonica	1512	10.70%	88.50%	0.79%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	99.50%	0.50%	0.00%	0.00%	NA
Indica II	465	97.00%	3.00%	0.00%	0.00%	NA
Indica III	913	96.20%	3.80%	0.00%	0.00%	NA
Indica Intermediate	786	97.50%	2.50%	0.00%	0.00%	NA
Temperate Japonica	767	8.50%	90.90%	0.65%	0.00%	NA
Tropical Japonica	504	10.10%	88.90%	0.99%	0.00%	NA
Japonica Intermediate	241	19.10%	80.10%	0.83%	0.00%	NA
VI/Aromatic	96	47.90%	52.10%	0.00%	0.00%	NA
Intermediate	90	53.30%	44.40%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0620424954	G -> A	LOC_Os06g35090.1	upstream_gene_variant ; 1289.0bp to feature; MODIFIER	silent_mutation	Average:49.372; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg0620424954	G -> A	LOC_Os06g35100.1	upstream_gene_variant ; 2232.0bp to feature; MODIFIER	silent_mutation	Average:49.372; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg0620424954	G -> A	LOC_Os06g35110.1	downstream_gene_variant ; 3885.0bp to feature; MODIFIER	silent_mutation	Average:49.372; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg0620424954	G -> A	LOC_Os06g35090-LOC_Os06g35100	intergenic_region ; MODIFIER	silent_mutation	Average:49.372; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0620424954	NA	2.12E-09	mr1097	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620424954	NA	1.13E-10	mr1172	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620424954	NA	4.79E-08	mr1488	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620424954	NA	1.15E-06	mr1677	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620424954	NA	5.18E-07	mr1797	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620424954	NA	5.18E-07	mr1801	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620424954	NA	2.42E-09	mr1806	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620424954	NA	5.51E-07	mr1824	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620424954	NA	4.77E-24	mr1024_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620424954	NA	1.50E-11	mr1097_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620424954	NA	5.17E-15	mr1148_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620424954	NA	6.81E-08	mr1275_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620424954	NA	5.39E-19	mr1276_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620424954	NA	7.44E-07	mr1302_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620424954	NA	1.12E-06	mr1418_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620424954	NA	1.47E-10	mr1506_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620424954	NA	1.33E-11	mr1646_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620424954	NA	1.48E-08	mr1660_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620424954	NA	6.38E-11	mr1714_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620424954	NA	3.18E-15	mr1726_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620424954	NA	1.32E-07	mr1765_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620424954	NA	1.84E-12	mr1806_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620424954	NA	6.66E-07	mr1824_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620424954	1.22E-06	NA	mr1827_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620424954	NA	1.48E-06	mr1827_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620424954	NA	1.44E-14	mr1950_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620424954	NA	4.23E-06	mr1992_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251