Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0620412828:

Variant ID: vg0620412828 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 20412828
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.02, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:

GGAGGCGTTCACGGCCGTGGTCTACAGTGAGGCTAGAAAGGCTGCAACAGCATTGCGGCGGCGACGCAGACATGCTGCCTCGTATGCCTAGAGAACTACG[G/A]
CGATGCTGACGTTCTCTGCGTGCTGCCGAACAGCGGCAACCTGTTCCAGCTGACGCCGCTCGTCAAGGTGACGCCGCTGTCTCTTGGCATTGCTCTATCG

Reverse complement sequence

CGATAGAGCAATGCCAAGAGACAGCGGCGTCACCTTGACGAGCGGCGTCAGCTGGAACAGGTTGCCGCTGTTCGGCAGCACGCAGAGAACGTCAGCATCG[C/T]
CGTAGTTCTCTAGGCATACGAGGCAGCATGTCTGCGTCGCCGCCGCAATGCTGTTGCAGCCTTTCTAGCCTCACTGTAGACCACGGCCGTGAACGCCTCC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.90%	21.50%	3.62%	0.00%	NA
All Indica	2759	58.40%	35.60%	6.02%	0.00%	NA
All Japonica	1512	99.20%	0.70%	0.13%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	19.70%	63.50%	16.81%	0.00%	NA
Indica II	465	41.30%	55.30%	3.44%	0.00%	NA
Indica III	913	93.50%	5.70%	0.77%	0.00%	NA
Indica Intermediate	786	57.00%	37.50%	5.47%	0.00%	NA
Temperate Japonica	767	99.00%	0.80%	0.26%	0.00%	NA
Tropical Japonica	504	99.60%	0.40%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	95.80%	4.20%	0.00%	0.00%	NA
Intermediate	90	74.40%	22.20%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0620412828	G -> A	LOC_Os06g35070.1	downstream_gene_variant ; 3708.0bp to feature; MODIFIER	silent_mutation	Average:63.87; most accessible tissue: Zhenshan97 young leaf, score: 82.31	N	N	N	N
vg0620412828	G -> A	LOC_Os06g35060-LOC_Os06g35070	intergenic_region ; MODIFIER	silent_mutation	Average:63.87; most accessible tissue: Zhenshan97 young leaf, score: 82.31	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0620412828	NA	4.11E-07	mr1877	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620412828	NA	2.30E-08	mr1929	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620412828	NA	7.01E-07	mr1063_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620412828	NA	1.52E-10	mr1091_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620412828	NA	5.75E-06	mr1346_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620412828	NA	7.96E-06	mr1539_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620412828	NA	1.05E-14	mr1583_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620412828	NA	2.03E-07	mr1583_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620412828	NA	3.63E-06	mr1732_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620412828	NA	3.28E-07	mr1834_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620412828	NA	1.96E-12	mr1850_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620412828	2.14E-06	1.33E-28	mr1877_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620412828	NA	4.64E-11	mr1877_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251