\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0620412828:

Variant ID: vg0620412828 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 20412828
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.02, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


GGAGGCGTTCACGGCCGTGGTCTACAGTGAGGCTAGAAAGGCTGCAACAGCATTGCGGCGGCGACGCAGACATGCTGCCTCGTATGCCTAGAGAACTACG[G/A]
CGATGCTGACGTTCTCTGCGTGCTGCCGAACAGCGGCAACCTGTTCCAGCTGACGCCGCTCGTCAAGGTGACGCCGCTGTCTCTTGGCATTGCTCTATCG

Reverse complement sequence

CGATAGAGCAATGCCAAGAGACAGCGGCGTCACCTTGACGAGCGGCGTCAGCTGGAACAGGTTGCCGCTGTTCGGCAGCACGCAGAGAACGTCAGCATCG[C/T]
CGTAGTTCTCTAGGCATACGAGGCAGCATGTCTGCGTCGCCGCCGCAATGCTGTTGCAGCCTTTCTAGCCTCACTGTAGACCACGGCCGTGAACGCCTCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.90% 21.50% 3.62% 0.00% NA
All Indica  2759 58.40% 35.60% 6.02% 0.00% NA
All Japonica  1512 99.20% 0.70% 0.13% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 19.70% 63.50% 16.81% 0.00% NA
Indica II  465 41.30% 55.30% 3.44% 0.00% NA
Indica III  913 93.50% 5.70% 0.77% 0.00% NA
Indica Intermediate  786 57.00% 37.50% 5.47% 0.00% NA
Temperate Japonica  767 99.00% 0.80% 0.26% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 74.40% 22.20% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0620412828 G -> A LOC_Os06g35070.1 downstream_gene_variant ; 3708.0bp to feature; MODIFIER silent_mutation Average:63.87; most accessible tissue: Zhenshan97 young leaf, score: 82.31 N N N N
vg0620412828 G -> A LOC_Os06g35060-LOC_Os06g35070 intergenic_region ; MODIFIER silent_mutation Average:63.87; most accessible tissue: Zhenshan97 young leaf, score: 82.31 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0620412828 NA 4.11E-07 mr1877 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620412828 NA 2.30E-08 mr1929 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620412828 NA 7.01E-07 mr1063_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620412828 NA 1.52E-10 mr1091_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620412828 NA 5.75E-06 mr1346_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620412828 NA 7.96E-06 mr1539_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620412828 NA 1.05E-14 mr1583_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620412828 NA 2.03E-07 mr1583_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620412828 NA 3.63E-06 mr1732_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620412828 NA 3.28E-07 mr1834_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620412828 NA 1.96E-12 mr1850_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620412828 2.14E-06 1.33E-28 mr1877_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620412828 NA 4.64E-11 mr1877_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251