\
| Variant ID: vg0620412828 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 20412828 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.02, others allele: 0.00, population size: 109. )
GGAGGCGTTCACGGCCGTGGTCTACAGTGAGGCTAGAAAGGCTGCAACAGCATTGCGGCGGCGACGCAGACATGCTGCCTCGTATGCCTAGAGAACTACG[G/A]
CGATGCTGACGTTCTCTGCGTGCTGCCGAACAGCGGCAACCTGTTCCAGCTGACGCCGCTCGTCAAGGTGACGCCGCTGTCTCTTGGCATTGCTCTATCG
CGATAGAGCAATGCCAAGAGACAGCGGCGTCACCTTGACGAGCGGCGTCAGCTGGAACAGGTTGCCGCTGTTCGGCAGCACGCAGAGAACGTCAGCATCG[C/T]
CGTAGTTCTCTAGGCATACGAGGCAGCATGTCTGCGTCGCCGCCGCAATGCTGTTGCAGCCTTTCTAGCCTCACTGTAGACCACGGCCGTGAACGCCTCC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 74.90% | 21.50% | 3.62% | 0.00% | NA |
| All Indica | 2759 | 58.40% | 35.60% | 6.02% | 0.00% | NA |
| All Japonica | 1512 | 99.20% | 0.70% | 0.13% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 19.70% | 63.50% | 16.81% | 0.00% | NA |
| Indica II | 465 | 41.30% | 55.30% | 3.44% | 0.00% | NA |
| Indica III | 913 | 93.50% | 5.70% | 0.77% | 0.00% | NA |
| Indica Intermediate | 786 | 57.00% | 37.50% | 5.47% | 0.00% | NA |
| Temperate Japonica | 767 | 99.00% | 0.80% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 74.40% | 22.20% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0620412828 | G -> A | LOC_Os06g35070.1 | downstream_gene_variant ; 3708.0bp to feature; MODIFIER | silent_mutation | Average:63.87; most accessible tissue: Zhenshan97 young leaf, score: 82.31 | N | N | N | N |
| vg0620412828 | G -> A | LOC_Os06g35060-LOC_Os06g35070 | intergenic_region ; MODIFIER | silent_mutation | Average:63.87; most accessible tissue: Zhenshan97 young leaf, score: 82.31 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0620412828 | NA | 4.11E-07 | mr1877 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620412828 | NA | 2.30E-08 | mr1929 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620412828 | NA | 7.01E-07 | mr1063_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620412828 | NA | 1.52E-10 | mr1091_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620412828 | NA | 5.75E-06 | mr1346_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620412828 | NA | 7.96E-06 | mr1539_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620412828 | NA | 1.05E-14 | mr1583_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620412828 | NA | 2.03E-07 | mr1583_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620412828 | NA | 3.63E-06 | mr1732_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620412828 | NA | 3.28E-07 | mr1834_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620412828 | NA | 1.96E-12 | mr1850_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620412828 | 2.14E-06 | 1.33E-28 | mr1877_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620412828 | NA | 4.64E-11 | mr1877_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |