Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0620356290:

Variant ID: vg0620356290 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 20356290
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CACTAACCTTTACTCAGGGACGAGCAAAGGGCTAAGTGTGGGGGGTTTTGTTGGCGGCTGTTAAATGCCGATTCTATACCGCCAACATCTGCATAAAGAT[T/C]
AGATAATAAAACATCTAACATAGTGATAGGTGCTTAATCTCACGTATTCCACAAGTGTTGATATATATTTGTATGCAGGTAATAAACCCCGGTGCGGGAG

Reverse complement sequence

CTCCCGCACCGGGGTTTATTACCTGCATACAAATATATATCAACACTTGTGGAATACGTGAGATTAAGCACCTATCACTATGTTAGATGTTTTATTATCT[A/G]
ATCTTTATGCAGATGTTGGCGGTATAGAATCGGCATTTAACAGCCGCCAACAAAACCCCCCACACTTAGCCCTTTGCTCGTCCCTGAGTAAAGGTTAGTG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	46.90%	36.50%	8.78%	7.85%	NA
All Indica	2759	78.30%	7.90%	9.71%	4.17%	NA
All Japonica	1512	0.70%	92.90%	1.59%	4.83%	NA
Aus	269	4.50%	6.30%	31.97%	57.25%	NA
Indica I	595	74.80%	13.90%	7.39%	3.87%	NA
Indica II	465	77.60%	8.00%	11.61%	2.80%	NA
Indica III	913	85.30%	1.40%	10.19%	3.07%	NA
Indica Intermediate	786	73.00%	10.70%	9.80%	6.49%	NA
Temperate Japonica	767	0.80%	93.90%	0.91%	4.43%	NA
Tropical Japonica	504	0.20%	93.50%	2.38%	3.97%	NA
Japonica Intermediate	241	1.70%	88.40%	2.07%	7.88%	NA
VI/Aromatic	96	6.20%	38.50%	32.29%	22.92%	NA
Intermediate	90	32.20%	53.30%	6.67%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0620356290	T -> C	LOC_Os06g35000.1	downstream_gene_variant ; 2951.0bp to feature; MODIFIER	silent_mutation	Average:34.932; most accessible tissue: Minghui63 root, score: 50.524	N	N	N	N
vg0620356290	T -> C	LOC_Os06g35010.1	downstream_gene_variant ; 4608.0bp to feature; MODIFIER	silent_mutation	Average:34.932; most accessible tissue: Minghui63 root, score: 50.524	N	N	N	N
vg0620356290	T -> C	LOC_Os06g35000-LOC_Os06g35010	intergenic_region ; MODIFIER	silent_mutation	Average:34.932; most accessible tissue: Minghui63 root, score: 50.524	N	N	N	N
vg0620356290	T -> DEL	N	N	silent_mutation	Average:34.932; most accessible tissue: Minghui63 root, score: 50.524	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0620356290	NA	1.19E-06	mr1781	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620356290	NA	2.34E-11	mr1949	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620356290	7.82E-07	5.42E-06	mr1486_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251