\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0620323442:

Variant ID: vg0620323442 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 20323442
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 115. )

Flanking Sequence (100 bp) in Reference Genome:


TACAACCAACCAACCATCGATCCTATTTTCCTGGATCTGATACCATCCACTTCCACGTTGTTTTTCCCGGATCGAGCAAGAGGGAGAGAGCACGGGCGAA[G/A]
GTTGGCGGCGGCGGCATCCTCCAGTGGCGGGTTATGGGTGAAATCGGTCGGAGACAGCGGCGCATCTACGGTCAATGGCGATGGCGAACAGGTTCCCTCC

Reverse complement sequence

GGAGGGAACCTGTTCGCCATCGCCATTGACCGTAGATGCGCCGCTGTCTCCGACCGATTTCACCCATAACCCGCCACTGGAGGATGCCGCCGCCGCCAAC[C/T]
TTCGCCCGTGCTCTCTCCCTCTTGCTCGATCCGGGAAAAACAACGTGGAAGTGGATGGTATCAGATCCAGGAAAATAGGATCGATGGTTGGTTGGTTGTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.10% 13.20% 7.68% 0.00% NA
All Indica  2759 67.50% 20.80% 11.74% 0.00% NA
All Japonica  1512 98.70% 0.50% 0.79% 0.00% NA
Aus  269 87.40% 10.00% 2.60% 0.00% NA
Indica I  595 34.30% 38.80% 26.89% 0.00% NA
Indica II  465 78.30% 11.20% 10.54% 0.00% NA
Indica III  913 82.30% 14.80% 2.96% 0.00% NA
Indica Intermediate  786 69.10% 19.70% 11.20% 0.00% NA
Temperate Japonica  767 98.70% 0.40% 0.91% 0.00% NA
Tropical Japonica  504 99.40% 0.00% 0.60% 0.00% NA
Japonica Intermediate  241 97.10% 2.10% 0.83% 0.00% NA
VI/Aromatic  96 77.10% 11.50% 11.46% 0.00% NA
Intermediate  90 83.30% 6.70% 10.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0620323442 G -> A LOC_Os06g34950.1 upstream_gene_variant ; 81.0bp to feature; MODIFIER silent_mutation Average:59.186; most accessible tissue: Zhenshan97 panicle, score: 86.788 N N N N
vg0620323442 G -> A LOC_Os06g34940.1 downstream_gene_variant ; 737.0bp to feature; MODIFIER silent_mutation Average:59.186; most accessible tissue: Zhenshan97 panicle, score: 86.788 N N N N
vg0620323442 G -> A LOC_Os06g34960.1 downstream_gene_variant ; 2840.0bp to feature; MODIFIER silent_mutation Average:59.186; most accessible tissue: Zhenshan97 panicle, score: 86.788 N N N N
vg0620323442 G -> A LOC_Os06g34940-LOC_Os06g34950 intergenic_region ; MODIFIER silent_mutation Average:59.186; most accessible tissue: Zhenshan97 panicle, score: 86.788 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0620323442 G A 0.0 -0.03 -0.03 -0.03 -0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0620323442 NA 2.19E-09 Heading_date Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0620323442 NA 2.19E-32 mr1026 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620323442 NA 4.22E-18 mr1026 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620323442 NA 3.55E-06 mr1074 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620323442 NA 8.20E-14 mr1118 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620323442 NA 4.05E-16 mr1161 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620323442 NA 2.93E-06 mr1261 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620323442 1.34E-06 8.33E-18 mr1495 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620323442 NA 3.08E-07 mr1496 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620323442 NA 1.69E-15 mr1870 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620323442 NA 8.26E-08 mr1870 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620323442 NA 8.27E-17 mr1118_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620323442 NA 3.31E-18 mr1118_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620323442 NA 3.20E-06 mr1123_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620323442 NA 5.79E-33 mr1161_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620323442 NA 1.46E-19 mr1161_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620323442 NA 1.49E-23 mr1495_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620323442 NA 2.78E-20 mr1495_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620323442 NA 1.32E-07 mr1496_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620323442 NA 8.21E-07 mr1531_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620323442 NA 2.55E-07 mr1870_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620323442 NA 1.21E-08 mr1936_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251