\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0620312022:

Variant ID: vg0620312022 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 20312022
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:


AAATGTGGTTGTACGGTGTCGTTTCATGCTTAACTTCATGGCTTGGTCTTTAATTGACCAGGGACGGTACTAGCCTTTCCCGGATACCACCCAAATCCAC[C/T]
GTCCGCCCCGGTCTAAAACAAAGGTTTTTAATTCCTTTCATGTCATCATTATCATGGCAATGTGGTGCTCATATCTCCACATGCCGCATCTTAATTACCT

Reverse complement sequence

AGGTAATTAAGATGCGGCATGTGGAGATATGAGCACCACATTGCCATGATAATGATGACATGAAAGGAATTAAAAACCTTTGTTTTAGACCGGGGCGGAC[G/A]
GTGGATTTGGGTGGTATCCGGGAAAGGCTAGTACCGTCCCTGGTCAATTAAAGACCAAGCCATGAAGTTAAGCATGAAACGACACCGTACAACCACATTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.20% 3.00% 16.65% 24.08% NA
All Indica  2759 33.40% 5.10% 23.70% 37.77% NA
All Japonica  1512 97.40% 0.00% 1.72% 0.86% NA
Aus  269 55.40% 0.40% 26.02% 18.22% NA
Indica I  595 26.10% 0.80% 32.44% 40.67% NA
Indica II  465 31.40% 1.90% 22.80% 43.87% NA
Indica III  913 37.50% 10.60% 19.50% 32.42% NA
Indica Intermediate  786 35.40% 3.90% 22.52% 38.17% NA
Temperate Japonica  767 96.70% 0.00% 1.96% 1.30% NA
Tropical Japonica  504 99.00% 0.00% 0.60% 0.40% NA
Japonica Intermediate  241 96.30% 0.00% 3.32% 0.41% NA
VI/Aromatic  96 56.20% 0.00% 27.08% 16.67% NA
Intermediate  90 67.80% 0.00% 12.22% 20.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0620312022 C -> T LOC_Os06g34920.1 upstream_gene_variant ; 328.0bp to feature; MODIFIER silent_mutation Average:6.719; most accessible tissue: Callus, score: 17.666 N N N N
vg0620312022 C -> T LOC_Os06g34930.1 downstream_gene_variant ; 2539.0bp to feature; MODIFIER silent_mutation Average:6.719; most accessible tissue: Callus, score: 17.666 N N N N
vg0620312022 C -> T LOC_Os06g34920-LOC_Os06g34930 intergenic_region ; MODIFIER silent_mutation Average:6.719; most accessible tissue: Callus, score: 17.666 N N N N
vg0620312022 C -> DEL N N silent_mutation Average:6.719; most accessible tissue: Callus, score: 17.666 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0620312022 3.66E-07 9.63E-11 mr1238 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620312022 3.29E-06 1.32E-08 mr1309 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620312022 3.00E-08 9.52E-13 mr1841 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620312022 8.73E-10 8.72E-10 mr1900 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620312022 8.08E-06 8.98E-09 mr1238_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620312022 4.11E-06 1.17E-08 mr1484_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620312022 NA 1.65E-09 mr1841_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620312022 NA 8.82E-08 mr1900_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251