\
| Variant ID: vg0620312022 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 20312022 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 209. )
AAATGTGGTTGTACGGTGTCGTTTCATGCTTAACTTCATGGCTTGGTCTTTAATTGACCAGGGACGGTACTAGCCTTTCCCGGATACCACCCAAATCCAC[C/T]
GTCCGCCCCGGTCTAAAACAAAGGTTTTTAATTCCTTTCATGTCATCATTATCATGGCAATGTGGTGCTCATATCTCCACATGCCGCATCTTAATTACCT
AGGTAATTAAGATGCGGCATGTGGAGATATGAGCACCACATTGCCATGATAATGATGACATGAAAGGAATTAAAAACCTTTGTTTTAGACCGGGGCGGAC[G/A]
GTGGATTTGGGTGGTATCCGGGAAAGGCTAGTACCGTCCCTGGTCAATTAAAGACCAAGCCATGAAGTTAAGCATGAAACGACACCGTACAACCACATTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.20% | 3.00% | 16.65% | 24.08% | NA |
| All Indica | 2759 | 33.40% | 5.10% | 23.70% | 37.77% | NA |
| All Japonica | 1512 | 97.40% | 0.00% | 1.72% | 0.86% | NA |
| Aus | 269 | 55.40% | 0.40% | 26.02% | 18.22% | NA |
| Indica I | 595 | 26.10% | 0.80% | 32.44% | 40.67% | NA |
| Indica II | 465 | 31.40% | 1.90% | 22.80% | 43.87% | NA |
| Indica III | 913 | 37.50% | 10.60% | 19.50% | 32.42% | NA |
| Indica Intermediate | 786 | 35.40% | 3.90% | 22.52% | 38.17% | NA |
| Temperate Japonica | 767 | 96.70% | 0.00% | 1.96% | 1.30% | NA |
| Tropical Japonica | 504 | 99.00% | 0.00% | 0.60% | 0.40% | NA |
| Japonica Intermediate | 241 | 96.30% | 0.00% | 3.32% | 0.41% | NA |
| VI/Aromatic | 96 | 56.20% | 0.00% | 27.08% | 16.67% | NA |
| Intermediate | 90 | 67.80% | 0.00% | 12.22% | 20.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0620312022 | C -> T | LOC_Os06g34920.1 | upstream_gene_variant ; 328.0bp to feature; MODIFIER | silent_mutation | Average:6.719; most accessible tissue: Callus, score: 17.666 | N | N | N | N |
| vg0620312022 | C -> T | LOC_Os06g34930.1 | downstream_gene_variant ; 2539.0bp to feature; MODIFIER | silent_mutation | Average:6.719; most accessible tissue: Callus, score: 17.666 | N | N | N | N |
| vg0620312022 | C -> T | LOC_Os06g34920-LOC_Os06g34930 | intergenic_region ; MODIFIER | silent_mutation | Average:6.719; most accessible tissue: Callus, score: 17.666 | N | N | N | N |
| vg0620312022 | C -> DEL | N | N | silent_mutation | Average:6.719; most accessible tissue: Callus, score: 17.666 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0620312022 | 3.66E-07 | 9.63E-11 | mr1238 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620312022 | 3.29E-06 | 1.32E-08 | mr1309 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620312022 | 3.00E-08 | 9.52E-13 | mr1841 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620312022 | 8.73E-10 | 8.72E-10 | mr1900 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620312022 | 8.08E-06 | 8.98E-09 | mr1238_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620312022 | 4.11E-06 | 1.17E-08 | mr1484_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620312022 | NA | 1.65E-09 | mr1841_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620312022 | NA | 8.82E-08 | mr1900_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |