Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0620296856:

Variant ID: vg0620296856 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 20296856
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CATAGGGCGGTAGATATCCTATATAATCTAAGTCAACATTGATATTTAACCTAATCGACTGCCTTCCAATAATGGACGTTAGCCGATTGAAGATTAGATA[A/G]
CAATATTGTCGAAGATTATATAAGATATATGATAACTCGATGAATTACATAAACAAGATTAGAGTATCATAAAGATGGAAACACTAATCCCGAGAACACA

Reverse complement sequence

TGTGTTCTCGGGATTAGTGTTTCCATCTTTATGATACTCTAATCTTGTTTATGTAATTCATCGAGTTATCATATATCTTATATAATCTTCGACAATATTG[T/C]
TATCTAATCTTCAATCGGCTAACGTCCATTATTGGAAGGCAGTCGATTAGGTTAAATATCAATGTTGACTTAGATTATATAGGATATCTACCGCCCTATG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.20%	1.40%	0.78%	24.57%	NA
All Indica	2759	58.90%	1.20%	0.94%	38.89%	NA
All Japonica	1512	99.10%	0.00%	0.00%	0.86%	NA
Aus	269	75.10%	1.10%	1.86%	21.93%	NA
Indica I	595	40.30%	0.00%	0.34%	59.33%	NA
Indica II	465	51.80%	0.90%	1.08%	46.24%	NA
Indica III	913	74.70%	2.00%	1.20%	22.12%	NA
Indica Intermediate	786	58.90%	1.50%	1.02%	38.55%	NA
Temperate Japonica	767	99.30%	0.00%	0.00%	0.65%	NA
Tropical Japonica	504	99.00%	0.00%	0.00%	0.99%	NA
Japonica Intermediate	241	98.80%	0.00%	0.00%	1.24%	NA
VI/Aromatic	96	63.50%	29.20%	6.25%	1.04%	NA
Intermediate	90	81.10%	2.20%	0.00%	16.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0620296856	A -> G	LOC_Os06g34910.1	upstream_gene_variant ; 3525.0bp to feature; MODIFIER	silent_mutation	Average:12.159; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N
vg0620296856	A -> G	LOC_Os06g34900.1	downstream_gene_variant ; 1456.0bp to feature; MODIFIER	silent_mutation	Average:12.159; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N
vg0620296856	A -> G	LOC_Os06g34900-LOC_Os06g34910	intergenic_region ; MODIFIER	silent_mutation	Average:12.159; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N
vg0620296856	A -> DEL	N	N	silent_mutation	Average:12.159; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0620296856	NA	9.61E-06	mr1295	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620296856	NA	2.05E-06	mr1850	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251