Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0620234044:

Variant ID: vg0620234044 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 20234044
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.00, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:


GAAGAAATAGTGATTAATTTGCCCACAATAGGACAAGACAGACATACATCACAATTTGCAGAAAGACCTCTAGAAGATAAACAAATTACATAGAGATCCT[A/G]
AAAATAAGCAAAGAAGGACTCTAAAAGAAAATTAAAAAGCAATCAAGTACTTACTTTGCTTCTTCTTCCGATCCGATGACCAAAACAATAAAGTCGATAG

Reverse complement sequence

CTATCGACTTTATTGTTTTGGTCATCGGATCGGAAGAAGAAGCAAAGTAAGTACTTGATTGCTTTTTAATTTTCTTTTAGAGTCCTTCTTTGCTTATTTT[T/C]
AGGATCTCTATGTAATTTGTTTATCTTCTAGAGGTCTTTCTGCAAATTGTGATGTATGTCTGTCTTGTCCTATTGTGGGCAAATTAATCACTATTTCTTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.90% 28.90% 0.04% 1.10% NA
All Indica  2759 94.90% 5.00% 0.00% 0.07% NA
All Japonica  1512 20.60% 79.10% 0.07% 0.20% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 95.10% 4.90% 0.00% 0.00% NA
Indica II  465 91.80% 8.20% 0.00% 0.00% NA
Indica III  913 99.10% 0.80% 0.00% 0.11% NA
Indica Intermediate  786 91.70% 8.10% 0.00% 0.13% NA
Temperate Japonica  767 12.90% 87.00% 0.13% 0.00% NA
Tropical Japonica  504 12.50% 87.50% 0.00% 0.00% NA
Japonica Intermediate  241 62.20% 36.50% 0.00% 1.24% NA
VI/Aromatic  96 55.20% 1.00% 1.04% 42.71% NA
Intermediate  90 57.80% 35.60% 0.00% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0620234044 A -> G LOC_Os06g34810.1 upstream_gene_variant ; 2370.0bp to feature; MODIFIER silent_mutation Average:78.278; most accessible tissue: Zhenshan97 panicle, score: 89.143 N N N N
vg0620234044 A -> G LOC_Os06g34820.1 downstream_gene_variant ; 2774.0bp to feature; MODIFIER silent_mutation Average:78.278; most accessible tissue: Zhenshan97 panicle, score: 89.143 N N N N
vg0620234044 A -> G LOC_Os06g34810-LOC_Os06g34820 intergenic_region ; MODIFIER silent_mutation Average:78.278; most accessible tissue: Zhenshan97 panicle, score: 89.143 N N N N
vg0620234044 A -> DEL N N silent_mutation Average:78.278; most accessible tissue: Zhenshan97 panicle, score: 89.143 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0620234044 A G 0.03 0.03 0.03 0.03 0.04 0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0620234044 NA 4.55E-16 mr1059 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620234044 NA 2.63E-16 mr1116 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620234044 NA 2.72E-16 mr1143 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620234044 4.73E-06 1.40E-17 mr1167 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620234044 NA 7.98E-11 mr1172 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620234044 NA 1.52E-06 mr1216 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620234044 NA 9.37E-13 mr1239 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620234044 NA 1.48E-07 mr1245 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620234044 NA 2.57E-06 mr1269 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620234044 NA 1.55E-15 mr1324 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620234044 NA 1.51E-10 mr1325 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620234044 NA 1.75E-13 mr1335 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620234044 3.13E-06 NA mr1502 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620234044 NA 4.22E-06 mr1532 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620234044 NA 1.63E-15 mr1535 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620234044 4.83E-06 4.05E-17 mr1675 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620234044 NA 4.81E-08 mr1677 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620234044 NA 3.70E-15 mr1726 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620234044 NA 1.32E-11 mr1949 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620234044 NA 4.36E-18 mr1950 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620234044 NA 1.25E-15 mr1969 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620234044 NA 2.76E-17 mr1995 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620234044 NA 4.50E-06 mr1242_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620234044 NA 6.84E-14 mr1496_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620234044 NA 3.52E-06 mr1781_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251