\
| Variant ID: vg0620227512 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 20227512 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AATTATTATGAAAAAATGTTTAAAAATAGATTTATCTCTGTTTTAATAGATAACGCCATTGATTTTGAACACACATTTGATCATTCATTTTATTAAAAAA[T/A]
TTACATAATTATAGTATATTTTATTGTGATTTGTTTTATCACTAATGTCGGTGACATGGGACCGGGAGTATCATGACTAGAGGTTTGGGCAGGAGCAATC
GATTGCTCCTGCCCAAACCTCTAGTCATGATACTCCCGGTCCCATGTCACCGACATTAGTGATAAAACAAATCACAATAAAATATACTATAATTATGTAA[A/T]
TTTTTTAATAAAATGAATGATCAAATGTGTGTTCAAAATCAATGGCGTTATCTATTAAAACAGAGATAAATCTATTTTTAAACATTTTTTCATAATAATT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.40% | 7.50% | 1.90% | 1.21% | NA |
| All Indica | 2759 | 98.00% | 0.90% | 1.05% | 0.00% | NA |
| All Japonica | 1512 | 71.40% | 21.20% | 3.64% | 3.70% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.30% | 0.20% | 0.50% | 0.00% | NA |
| Indica II | 465 | 96.60% | 1.30% | 2.15% | 0.00% | NA |
| Indica III | 913 | 97.90% | 1.10% | 0.99% | 0.00% | NA |
| Indica Intermediate | 786 | 98.10% | 1.00% | 0.89% | 0.00% | NA |
| Temperate Japonica | 767 | 88.70% | 1.70% | 3.00% | 6.65% | NA |
| Tropical Japonica | 504 | 35.70% | 57.90% | 5.75% | 0.60% | NA |
| Japonica Intermediate | 241 | 91.30% | 6.60% | 1.24% | 0.83% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 81.10% | 11.10% | 6.67% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0620227512 | T -> A | LOC_Os06g34790.1 | upstream_gene_variant ; 2717.0bp to feature; MODIFIER | silent_mutation | Average:30.257; most accessible tissue: Callus, score: 49.403 | N | N | N | N |
| vg0620227512 | T -> A | LOC_Os06g34800.1 | downstream_gene_variant ; 1625.0bp to feature; MODIFIER | silent_mutation | Average:30.257; most accessible tissue: Callus, score: 49.403 | N | N | N | N |
| vg0620227512 | T -> A | LOC_Os06g34810.1 | downstream_gene_variant ; 3255.0bp to feature; MODIFIER | silent_mutation | Average:30.257; most accessible tissue: Callus, score: 49.403 | N | N | N | N |
| vg0620227512 | T -> A | LOC_Os06g34800-LOC_Os06g34810 | intergenic_region ; MODIFIER | silent_mutation | Average:30.257; most accessible tissue: Callus, score: 49.403 | N | N | N | N |
| vg0620227512 | T -> DEL | N | N | silent_mutation | Average:30.257; most accessible tissue: Callus, score: 49.403 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0620227512 | 1.39E-06 | NA | mr1334 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620227512 | NA | 5.28E-15 | mr1334 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620227512 | NA | 7.12E-07 | mr1250_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620227512 | 3.80E-07 | NA | mr1334_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620227512 | NA | 8.21E-16 | mr1334_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620227512 | NA | 3.30E-07 | mr1786_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620227512 | NA | 2.06E-10 | mr1991_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |