\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0620227512:

Variant ID: vg0620227512 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 20227512
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATTATTATGAAAAAATGTTTAAAAATAGATTTATCTCTGTTTTAATAGATAACGCCATTGATTTTGAACACACATTTGATCATTCATTTTATTAAAAAA[T/A]
TTACATAATTATAGTATATTTTATTGTGATTTGTTTTATCACTAATGTCGGTGACATGGGACCGGGAGTATCATGACTAGAGGTTTGGGCAGGAGCAATC

Reverse complement sequence

GATTGCTCCTGCCCAAACCTCTAGTCATGATACTCCCGGTCCCATGTCACCGACATTAGTGATAAAACAAATCACAATAAAATATACTATAATTATGTAA[A/T]
TTTTTTAATAAAATGAATGATCAAATGTGTGTTCAAAATCAATGGCGTTATCTATTAAAACAGAGATAAATCTATTTTTAAACATTTTTTCATAATAATT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.40% 7.50% 1.90% 1.21% NA
All Indica  2759 98.00% 0.90% 1.05% 0.00% NA
All Japonica  1512 71.40% 21.20% 3.64% 3.70% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.30% 0.20% 0.50% 0.00% NA
Indica II  465 96.60% 1.30% 2.15% 0.00% NA
Indica III  913 97.90% 1.10% 0.99% 0.00% NA
Indica Intermediate  786 98.10% 1.00% 0.89% 0.00% NA
Temperate Japonica  767 88.70% 1.70% 3.00% 6.65% NA
Tropical Japonica  504 35.70% 57.90% 5.75% 0.60% NA
Japonica Intermediate  241 91.30% 6.60% 1.24% 0.83% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 81.10% 11.10% 6.67% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0620227512 T -> A LOC_Os06g34790.1 upstream_gene_variant ; 2717.0bp to feature; MODIFIER silent_mutation Average:30.257; most accessible tissue: Callus, score: 49.403 N N N N
vg0620227512 T -> A LOC_Os06g34800.1 downstream_gene_variant ; 1625.0bp to feature; MODIFIER silent_mutation Average:30.257; most accessible tissue: Callus, score: 49.403 N N N N
vg0620227512 T -> A LOC_Os06g34810.1 downstream_gene_variant ; 3255.0bp to feature; MODIFIER silent_mutation Average:30.257; most accessible tissue: Callus, score: 49.403 N N N N
vg0620227512 T -> A LOC_Os06g34800-LOC_Os06g34810 intergenic_region ; MODIFIER silent_mutation Average:30.257; most accessible tissue: Callus, score: 49.403 N N N N
vg0620227512 T -> DEL N N silent_mutation Average:30.257; most accessible tissue: Callus, score: 49.403 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0620227512 1.39E-06 NA mr1334 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620227512 NA 5.28E-15 mr1334 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620227512 NA 7.12E-07 mr1250_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620227512 3.80E-07 NA mr1334_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620227512 NA 8.21E-16 mr1334_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620227512 NA 3.30E-07 mr1786_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620227512 NA 2.06E-10 mr1991_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251