Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0620204835:

Variant ID: vg0620204835 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 20204835
Reference Allele: T	Alternative Allele: G
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.80, G: 0.20, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:

TCTGAGGATGTCTCCGCTCGGCGAGGTCAGCGTGACCCCCGCACCGGCGCCCTGAAGAGACAGGGACCCGTCGAACTGCATCACCCAGTAGGCGGTGTGA[T/G]
GCAGCTGCGAGGGGCCCGAGCTGGCCTCGGGAATGGAGACGGGCTCGGGAGCTGGGGTCCACTCTGCCACAAAGTCGGCGAGGGCCTGGCTCTTGATAGC

Reverse complement sequence

GCTATCAAGAGCCAGGCCCTCGCCGACTTTGTGGCAGAGTGGACCCCAGCTCCCGAGCCCGTCTCCATTCCCGAGGCCAGCTCGGGCCCCTCGCAGCTGC[A/C]
TCACACCGCCTACTGGGTGATGCAGTTCGACGGGTCCCTGTCTCTTCAGGGCGCCGGTGCGGGGGTCACGCTGACCTCGCCGAGCGGAGACATCCTCAGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	57.20%	39.00%	0.93%	2.90%	NA
All Indica	2759	91.50%	8.20%	0.25%	0.00%	NA
All Japonica	1512	3.00%	87.30%	0.99%	8.73%	NA
Aus	269	29.00%	65.10%	5.58%	0.37%	NA
Indica I	595	92.60%	7.40%	0.00%	0.00%	NA
Indica II	465	87.70%	11.80%	0.43%	0.00%	NA
Indica III	913	96.20%	3.60%	0.22%	0.00%	NA
Indica Intermediate	786	87.50%	12.10%	0.38%	0.00%	NA
Temperate Japonica	767	3.50%	84.50%	0.65%	11.34%	NA
Tropical Japonica	504	2.40%	92.50%	1.39%	3.77%	NA
Japonica Intermediate	241	2.50%	85.50%	1.24%	10.79%	NA
VI/Aromatic	96	15.60%	79.20%	3.12%	2.08%	NA
Intermediate	90	43.30%	50.00%	4.44%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0620204835	T -> G	LOC_Os06g34760.1	missense_variant ; p.His1374Pro; MODERATE	nonsynonymous_codon ; H1374S	Average:21.933; most accessible tissue: Zhenshan97 flag leaf, score: 35.167	probably damaging	-2.36	DELETERIOUS	0.01
vg0620204835	T -> G	LOC_Os06g34760.1	missense_variant ; p.His1374Pro; MODERATE	nonsynonymous_codon ; H1374P	Average:21.933; most accessible tissue: Zhenshan97 flag leaf, score: 35.167	probably damaging	-3.215	TOLERATED	1.00
vg0620204835	T -> DEL	LOC_Os06g34760.1	N	frameshift_variant	Average:21.933; most accessible tissue: Zhenshan97 flag leaf, score: 35.167	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0620204835	NA	1.04E-11	mr1172	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620204835	NA	5.38E-06	mr1864	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620204835	NA	5.41E-20	mr1042_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620204835	NA	1.10E-08	mr1084_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620204835	4.18E-06	NA	mr1089_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620204835	NA	5.20E-12	mr1097_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620204835	4.76E-06	NA	mr1182_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620204835	NA	1.15E-08	mr1205_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620204835	NA	4.06E-07	mr1269_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620204835	NA	3.47E-08	mr1275_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620204835	5.72E-06	NA	mr1282_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620204835	NA	5.30E-06	mr1405_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620204835	NA	1.49E-08	mr1478_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620204835	NA	1.22E-08	mr1479_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620204835	NA	1.31E-06	mr1488_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620204835	NA	4.54E-10	mr1506_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620204835	NA	1.97E-10	mr1646_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620204835	NA	1.71E-11	mr1667_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620204835	NA	3.48E-07	mr1668_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620204835	NA	4.44E-07	mr1677_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620204835	NA	7.85E-11	mr1680_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620204835	NA	9.30E-09	mr1681_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620204835	NA	1.31E-15	mr1726_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620204835	NA	6.01E-11	mr1940_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620204835	NA	2.33E-16	mr1950_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251