\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0620204835:

Variant ID: vg0620204835 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 20204835
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.80, G: 0.20, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


TCTGAGGATGTCTCCGCTCGGCGAGGTCAGCGTGACCCCCGCACCGGCGCCCTGAAGAGACAGGGACCCGTCGAACTGCATCACCCAGTAGGCGGTGTGA[T/G]
GCAGCTGCGAGGGGCCCGAGCTGGCCTCGGGAATGGAGACGGGCTCGGGAGCTGGGGTCCACTCTGCCACAAAGTCGGCGAGGGCCTGGCTCTTGATAGC

Reverse complement sequence

GCTATCAAGAGCCAGGCCCTCGCCGACTTTGTGGCAGAGTGGACCCCAGCTCCCGAGCCCGTCTCCATTCCCGAGGCCAGCTCGGGCCCCTCGCAGCTGC[A/C]
TCACACCGCCTACTGGGTGATGCAGTTCGACGGGTCCCTGTCTCTTCAGGGCGCCGGTGCGGGGGTCACGCTGACCTCGCCGAGCGGAGACATCCTCAGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.20% 39.00% 0.93% 2.90% NA
All Indica  2759 91.50% 8.20% 0.25% 0.00% NA
All Japonica  1512 3.00% 87.30% 0.99% 8.73% NA
Aus  269 29.00% 65.10% 5.58% 0.37% NA
Indica I  595 92.60% 7.40% 0.00% 0.00% NA
Indica II  465 87.70% 11.80% 0.43% 0.00% NA
Indica III  913 96.20% 3.60% 0.22% 0.00% NA
Indica Intermediate  786 87.50% 12.10% 0.38% 0.00% NA
Temperate Japonica  767 3.50% 84.50% 0.65% 11.34% NA
Tropical Japonica  504 2.40% 92.50% 1.39% 3.77% NA
Japonica Intermediate  241 2.50% 85.50% 1.24% 10.79% NA
VI/Aromatic  96 15.60% 79.20% 3.12% 2.08% NA
Intermediate  90 43.30% 50.00% 4.44% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0620204835 T -> G LOC_Os06g34760.1 missense_variant ; p.His1374Pro; MODERATE nonsynonymous_codon ; H1374S Average:21.933; most accessible tissue: Zhenshan97 flag leaf, score: 35.167 probably damaging -2.36 DELETERIOUS 0.01
vg0620204835 T -> G LOC_Os06g34760.1 missense_variant ; p.His1374Pro; MODERATE nonsynonymous_codon ; H1374P Average:21.933; most accessible tissue: Zhenshan97 flag leaf, score: 35.167 probably damaging -3.215 TOLERATED 1.00
vg0620204835 T -> DEL LOC_Os06g34760.1 N frameshift_variant Average:21.933; most accessible tissue: Zhenshan97 flag leaf, score: 35.167 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0620204835 NA 1.04E-11 mr1172 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620204835 NA 5.38E-06 mr1864 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620204835 NA 5.41E-20 mr1042_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620204835 NA 1.10E-08 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620204835 4.18E-06 NA mr1089_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620204835 NA 5.20E-12 mr1097_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620204835 4.76E-06 NA mr1182_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620204835 NA 1.15E-08 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620204835 NA 4.06E-07 mr1269_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620204835 NA 3.47E-08 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620204835 5.72E-06 NA mr1282_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620204835 NA 5.30E-06 mr1405_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620204835 NA 1.49E-08 mr1478_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620204835 NA 1.22E-08 mr1479_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620204835 NA 1.31E-06 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620204835 NA 4.54E-10 mr1506_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620204835 NA 1.97E-10 mr1646_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620204835 NA 1.71E-11 mr1667_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620204835 NA 3.48E-07 mr1668_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620204835 NA 4.44E-07 mr1677_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620204835 NA 7.85E-11 mr1680_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620204835 NA 9.30E-09 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620204835 NA 1.31E-15 mr1726_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620204835 NA 6.01E-11 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620204835 NA 2.33E-16 mr1950_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251