| Variant ID: vg0620153786 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 20153786 |
| Reference Allele: T | Alternative Allele: C,A |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.80, T: 0.22, others allele: 0.00, population size: 59. )
CGCCTCTCAGGAAGTGGCTCCATCAGCATAAAATCATCATGCAATAACCCATCCCACACAAGTTAAGAATTTAGAGTCTAGCCAAGTGTAATACACGTCC[T/C,A]
AGTGCTCAATAACCGCAATCACGGCTATTCGAATAGATTTGGTTTACTTACACTATAGTGGATGTACACTTTACCCGCACTCCGCGACTGCCGAACACAT
ATGTGTTCGGCAGTCGCGGAGTGCGGGTAAAGTGTACATCCACTATAGTGTAAGTAAACCAAATCTATTCGAATAGCCGTGATTGCGGTTATTGAGCACT[A/G,T]
GGACGTGTATTACACTTGGCTAGACTCTAAATTCTTAACTTGTGTGGGATGGGTTATTGCATGATGATTTTATGCTGATGGAGCCACTTCCTGAGAGGCG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.70% | 25.10% | 0.17% | 8.04% | NA |
| All Indica | 2759 | 95.10% | 4.60% | 0.11% | 0.25% | NA |
| All Japonica | 1512 | 9.50% | 68.40% | 0.33% | 21.76% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 92.70% | 5.80% | 0.43% | 1.08% | NA |
| Indica III | 913 | 99.10% | 0.80% | 0.00% | 0.11% | NA |
| Indica Intermediate | 786 | 92.00% | 7.80% | 0.13% | 0.13% | NA |
| Temperate Japonica | 767 | 8.20% | 80.10% | 0.13% | 11.60% | NA |
| Tropical Japonica | 504 | 8.10% | 68.70% | 0.40% | 22.82% | NA |
| Japonica Intermediate | 241 | 16.60% | 30.70% | 0.83% | 51.87% | NA |
| VI/Aromatic | 96 | 66.70% | 0.00% | 0.00% | 33.33% | NA |
| Intermediate | 90 | 55.60% | 31.10% | 0.00% | 13.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0620153786 | T -> C | LOC_Os06g34670.1 | upstream_gene_variant ; 3535.0bp to feature; MODIFIER | silent_mutation | Average:37.022; most accessible tissue: Minghui63 young leaf, score: 51.901 | N | N | N | N |
| vg0620153786 | T -> C | LOC_Os06g34680.1 | upstream_gene_variant ; 2034.0bp to feature; MODIFIER | silent_mutation | Average:37.022; most accessible tissue: Minghui63 young leaf, score: 51.901 | N | N | N | N |
| vg0620153786 | T -> C | LOC_Os06g34690.1 | upstream_gene_variant ; 4855.0bp to feature; MODIFIER | silent_mutation | Average:37.022; most accessible tissue: Minghui63 young leaf, score: 51.901 | N | N | N | N |
| vg0620153786 | T -> C | LOC_Os06g34680-LOC_Os06g34690 | intergenic_region ; MODIFIER | silent_mutation | Average:37.022; most accessible tissue: Minghui63 young leaf, score: 51.901 | N | N | N | N |
| vg0620153786 | T -> A | LOC_Os06g34670.1 | upstream_gene_variant ; 3535.0bp to feature; MODIFIER | N | Average:37.022; most accessible tissue: Minghui63 young leaf, score: 51.901 | N | N | N | N |
| vg0620153786 | T -> A | LOC_Os06g34680.1 | upstream_gene_variant ; 2034.0bp to feature; MODIFIER | N | Average:37.022; most accessible tissue: Minghui63 young leaf, score: 51.901 | N | N | N | N |
| vg0620153786 | T -> A | LOC_Os06g34690.1 | upstream_gene_variant ; 4855.0bp to feature; MODIFIER | N | Average:37.022; most accessible tissue: Minghui63 young leaf, score: 51.901 | N | N | N | N |
| vg0620153786 | T -> A | LOC_Os06g34680-LOC_Os06g34690 | intergenic_region ; MODIFIER | N | Average:37.022; most accessible tissue: Minghui63 young leaf, score: 51.901 | N | N | N | N |
| vg0620153786 | T -> DEL | N | N | silent_mutation | Average:37.022; most accessible tissue: Minghui63 young leaf, score: 51.901 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0620153786 | NA | 4.18E-15 | mr1165 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620153786 | NA | 2.48E-07 | mr1245 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620153786 | NA | 3.27E-15 | mr1324 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620153786 | NA | 7.37E-13 | mr1335 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620153786 | NA | 4.14E-14 | mr1478 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620153786 | NA | 8.82E-15 | mr1675 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620153786 | NA | 2.02E-06 | mr1677 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620153786 | NA | 1.84E-14 | mr1726 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620153786 | NA | 1.44E-08 | mr1806 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620153786 | NA | 1.51E-16 | mr1950 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620153786 | NA | 1.66E-14 | mr1969 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620153786 | NA | 3.13E-07 | mr1979 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620153786 | 9.00E-09 | 5.26E-10 | mr1165_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620153786 | 5.25E-07 | 5.25E-07 | mr1477_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620153786 | 8.13E-06 | 8.13E-06 | mr1478_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620153786 | 1.02E-06 | 1.02E-06 | mr1971_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |