\
| Variant ID: vg0620149436 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 20149436 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.04, others allele: 0.00, population size: 295. )
GGTCTCTTTTTACTAACTCCAGATGTTCCAGGAGAGCAATTATCAGGACCAGTAGGCGATGGTAATGTGTCAGAGTCTTCTTCAACAATGTCAATAGGAT[G/A]
TGCATAGGTAGACACATCATTCAATCCTTCATGGTCACTACTACCAGATTTGTTATCAATGTCGCAGCATGTTTGCTAGTCTATGGCAAGAGAGCCATTC
GAATGGCTCTCTTGCCATAGACTAGCAAACATGCTGCGACATTGATAACAAATCTGGTAGTAGTGACCATGAAGGATTGAATGATGTGTCTACCTATGCA[C/T]
ATCCTATTGACATTGTTGAAGAAGACTCTGACACATTACCATCGCCTACTGGTCCTGATAATTGCTCTCCTGGAACATCTGGAGTTAGTAAAAAGAGACC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 81.40% | 16.30% | 0.25% | 2.05% | NA |
| All Indica | 2759 | 83.60% | 15.40% | 0.07% | 0.91% | NA |
| All Japonica | 1512 | 93.60% | 1.40% | 0.60% | 4.43% | NA |
| Aus | 269 | 1.50% | 98.10% | 0.00% | 0.37% | NA |
| Indica I | 595 | 86.70% | 13.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 85.40% | 12.70% | 0.22% | 1.72% | NA |
| Indica III | 913 | 78.20% | 20.60% | 0.00% | 1.20% | NA |
| Indica Intermediate | 786 | 86.50% | 12.60% | 0.13% | 0.76% | NA |
| Temperate Japonica | 767 | 93.90% | 1.20% | 0.65% | 4.30% | NA |
| Tropical Japonica | 504 | 96.00% | 2.00% | 0.00% | 1.98% | NA |
| Japonica Intermediate | 241 | 87.60% | 0.80% | 1.66% | 9.96% | NA |
| VI/Aromatic | 96 | 46.90% | 51.00% | 0.00% | 2.08% | NA |
| Intermediate | 90 | 82.20% | 14.40% | 1.11% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0620149436 | G -> A | LOC_Os06g34670.1 | missense_variant ; p.His121Tyr; MODERATE | nonsynonymous_codon ; H121Y | Average:54.165; most accessible tissue: Minghui63 panicle, score: 75.788 | benign |
1.3 |
TOLERATED | 0.10 |
| vg0620149436 | G -> DEL | LOC_Os06g34670.1 | N | frameshift_variant | Average:54.165; most accessible tissue: Minghui63 panicle, score: 75.788 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0620149436 | NA | 1.30E-06 | mr1006 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620149436 | NA | 4.46E-06 | mr1007 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620149436 | NA | 1.92E-06 | mr1052 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620149436 | NA | 6.56E-07 | mr1369 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620149436 | NA | 3.87E-07 | mr1652 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620149436 | NA | 1.35E-07 | mr1706 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620149436 | NA | 2.35E-06 | mr1121_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620149436 | NA | 7.16E-07 | mr1211_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620149436 | NA | 9.58E-08 | mr1929_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |