\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0620101204:

Variant ID: vg0620101204 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 20101204
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.75, T: 0.25, others allele: 0.00, population size: 177. )

Flanking Sequence (100 bp) in Reference Genome:


GCCAACATTGGACCAAAGTAGGATGGTCACCCTAGCAACAGGGCACATGAAAACAAATATTGGAGGTAGGACCAAATTACTTCCTCCGTCCCGAAAAGCT[T/C]
GACGTTCCAAGCATTATGACACAAATTAGCTTATAGAGCAAATTACCAATCCACCCTCCATTTATCAGCTATTGCTAGAATGAATGAGCATGCACTCAAT

Reverse complement sequence

ATTGAGTGCATGCTCATTCATTCTAGCAATAGCTGATAAATGGAGGGTGGATTGGTAATTTGCTCTATAAGCTAATTTGTGTCATAATGCTTGGAACGTC[A/G]
AGCTTTTCGGGACGGAGGAAGTAATTTGGTCCTACCTCCAATATTTGTTTTCATGTGCCCTGTTGCTAGGGTGACCATCCTACTTTGGTCCAATGTTGGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.20% 27.20% 0.11% 7.45% NA
All Indica  2759 95.10% 4.60% 0.04% 0.33% NA
All Japonica  1512 5.20% 74.50% 0.20% 20.17% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 95.00% 5.00% 0.00% 0.00% NA
Indica II  465 92.70% 5.80% 0.00% 1.51% NA
Indica III  913 99.30% 0.50% 0.00% 0.11% NA
Indica Intermediate  786 91.60% 8.10% 0.13% 0.13% NA
Temperate Japonica  767 3.30% 85.80% 0.13% 10.82% NA
Tropical Japonica  504 7.70% 71.00% 0.00% 21.23% NA
Japonica Intermediate  241 5.80% 45.60% 0.83% 47.72% NA
VI/Aromatic  96 67.70% 2.10% 1.04% 29.17% NA
Intermediate  90 53.30% 35.60% 0.00% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0620101204 T -> C LOC_Os06g34570.1 upstream_gene_variant ; 4804.0bp to feature; MODIFIER silent_mutation Average:68.743; most accessible tissue: Zhenshan97 root, score: 85.432 N N N N
vg0620101204 T -> C LOC_Os06g34560.1 downstream_gene_variant ; 708.0bp to feature; MODIFIER silent_mutation Average:68.743; most accessible tissue: Zhenshan97 root, score: 85.432 N N N N
vg0620101204 T -> C LOC_Os06g34564.1 downstream_gene_variant ; 1484.0bp to feature; MODIFIER silent_mutation Average:68.743; most accessible tissue: Zhenshan97 root, score: 85.432 N N N N
vg0620101204 T -> C LOC_Os06g34560-LOC_Os06g34564 intergenic_region ; MODIFIER silent_mutation Average:68.743; most accessible tissue: Zhenshan97 root, score: 85.432 N N N N
vg0620101204 T -> DEL N N silent_mutation Average:68.743; most accessible tissue: Zhenshan97 root, score: 85.432 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0620101204 NA 4.43E-06 mr1216 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620101204 NA 3.59E-06 mr1532 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620101204 NA 5.10E-07 mr1690 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620101204 1.33E-06 NA mr1720 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251