Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0620101204:

Variant ID: vg0620101204 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 20101204
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.75, T: 0.25, others allele: 0.00, population size: 177. )

Flanking Sequence (100 bp) in Reference Genome:

GCCAACATTGGACCAAAGTAGGATGGTCACCCTAGCAACAGGGCACATGAAAACAAATATTGGAGGTAGGACCAAATTACTTCCTCCGTCCCGAAAAGCT[T/C]
GACGTTCCAAGCATTATGACACAAATTAGCTTATAGAGCAAATTACCAATCCACCCTCCATTTATCAGCTATTGCTAGAATGAATGAGCATGCACTCAAT

Reverse complement sequence

ATTGAGTGCATGCTCATTCATTCTAGCAATAGCTGATAAATGGAGGGTGGATTGGTAATTTGCTCTATAAGCTAATTTGTGTCATAATGCTTGGAACGTC[A/G]
AGCTTTTCGGGACGGAGGAAGTAATTTGGTCCTACCTCCAATATTTGTTTTCATGTGCCCTGTTGCTAGGGTGACCATCCTACTTTGGTCCAATGTTGGC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.20%	27.20%	0.11%	7.45%	NA
All Indica	2759	95.10%	4.60%	0.04%	0.33%	NA
All Japonica	1512	5.20%	74.50%	0.20%	20.17%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	95.00%	5.00%	0.00%	0.00%	NA
Indica II	465	92.70%	5.80%	0.00%	1.51%	NA
Indica III	913	99.30%	0.50%	0.00%	0.11%	NA
Indica Intermediate	786	91.60%	8.10%	0.13%	0.13%	NA
Temperate Japonica	767	3.30%	85.80%	0.13%	10.82%	NA
Tropical Japonica	504	7.70%	71.00%	0.00%	21.23%	NA
Japonica Intermediate	241	5.80%	45.60%	0.83%	47.72%	NA
VI/Aromatic	96	67.70%	2.10%	1.04%	29.17%	NA
Intermediate	90	53.30%	35.60%	0.00%	11.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0620101204	T -> C	LOC_Os06g34570.1	upstream_gene_variant ; 4804.0bp to feature; MODIFIER	silent_mutation	Average:68.743; most accessible tissue: Zhenshan97 root, score: 85.432	N	N	N	N
vg0620101204	T -> C	LOC_Os06g34560.1	downstream_gene_variant ; 708.0bp to feature; MODIFIER	silent_mutation	Average:68.743; most accessible tissue: Zhenshan97 root, score: 85.432	N	N	N	N
vg0620101204	T -> C	LOC_Os06g34564.1	downstream_gene_variant ; 1484.0bp to feature; MODIFIER	silent_mutation	Average:68.743; most accessible tissue: Zhenshan97 root, score: 85.432	N	N	N	N
vg0620101204	T -> C	LOC_Os06g34560-LOC_Os06g34564	intergenic_region ; MODIFIER	silent_mutation	Average:68.743; most accessible tissue: Zhenshan97 root, score: 85.432	N	N	N	N
vg0620101204	T -> DEL	N	N	silent_mutation	Average:68.743; most accessible tissue: Zhenshan97 root, score: 85.432	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0620101204	NA	4.43E-06	mr1216	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620101204	NA	3.59E-06	mr1532	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620101204	NA	5.10E-07	mr1690	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620101204	1.33E-06	NA	mr1720	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251