\
| Variant ID: vg0620065391 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 20065391 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ATTTAGACTTAATCTTGTTGCTTATCTTTAGTGTGAGTTGTAAATTAGTGCGTGCACGAGTTAGCTTGATCAAGAAAGTGTTAGCCTAAAACCGGAAGAC[G/A]
TTGGCCTAACCGAGAGAAAGCCTTAAGCTCAAAAGCCGCTCAAGAGGTGAGAGACTCCCCCCACTTTAAAGTTGGTTTAACTCCCCCTAAATAAGTAATG
CATTACTTATTTAGGGGGAGTTAAACCAACTTTAAAGTGGGGGGAGTCTCTCACCTCTTGAGCGGCTTTTGAGCTTAAGGCTTTCTCTCGGTTAGGCCAA[C/T]
GTCTTCCGGTTTTAGGCTAACACTTTCTTGATCAAGCTAACTCGTGCACGCACTAATTTACAACTCACACTAAAGATAAGCAACAAGATTAAGTCTAAAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 84.30% | 6.40% | 2.18% | 7.17% | NA |
| All Indica | 2759 | 99.10% | 0.40% | 0.18% | 0.36% | NA |
| All Japonica | 1512 | 56.00% | 18.70% | 5.03% | 20.30% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 97.40% | 0.60% | 0.43% | 1.51% | NA |
| Indica III | 913 | 99.70% | 0.20% | 0.00% | 0.11% | NA |
| Indica Intermediate | 786 | 98.90% | 0.60% | 0.25% | 0.25% | NA |
| Temperate Japonica | 767 | 84.00% | 0.80% | 4.69% | 10.56% | NA |
| Tropical Japonica | 504 | 22.20% | 51.20% | 4.76% | 21.83% | NA |
| Japonica Intermediate | 241 | 37.80% | 7.50% | 6.64% | 48.13% | NA |
| VI/Aromatic | 96 | 69.80% | 0.00% | 16.67% | 13.54% | NA |
| Intermediate | 90 | 73.30% | 10.00% | 6.67% | 10.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0620065391 | G -> A | LOC_Os06g34480.1 | upstream_gene_variant ; 4422.0bp to feature; MODIFIER | silent_mutation | Average:77.94; most accessible tissue: Zhenshan97 panicle, score: 87.451 | N | N | N | N |
| vg0620065391 | G -> A | LOC_Os06g34470.1 | downstream_gene_variant ; 222.0bp to feature; MODIFIER | silent_mutation | Average:77.94; most accessible tissue: Zhenshan97 panicle, score: 87.451 | N | N | N | N |
| vg0620065391 | G -> A | LOC_Os06g34470-LOC_Os06g34480 | intergenic_region ; MODIFIER | silent_mutation | Average:77.94; most accessible tissue: Zhenshan97 panicle, score: 87.451 | N | N | N | N |
| vg0620065391 | G -> DEL | N | N | silent_mutation | Average:77.94; most accessible tissue: Zhenshan97 panicle, score: 87.451 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0620065391 | NA | 3.44E-06 | mr1083 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620065391 | 6.80E-07 | NA | mr1301 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620065391 | NA | 1.19E-06 | mr1304 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620065391 | NA | 5.41E-06 | mr1350 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620065391 | 1.51E-07 | NA | mr1301_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |