\
| Variant ID: vg0619961711 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 19961711 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TCTGCCTTTGTAGCCCCCGAGCTGATGTTGGGGGCGACCGGGCTATCTTCGCCGCTTGCCTCTTTCACTGATGGCCTCATCAGGACGTCCAAAAAGGTGC[T/C]
AGTTTCAAGTGGCTCTCATCTGGACGCACGTCGTGCTAGATCATCCGGTTCGATGTTGTCTTTGCGGTATACATGTCGGACCTCGATCCCATCAAACCTT
AAGGTTTGATGGGATCGAGGTCCGACATGTATACCGCAAAGACAACATCGAACCGGATGATCTAGCACGACGTGCGTCCAGATGAGAGCCACTTGAAACT[A/G]
GCACCTTTTTGGACGTCCTGATGAGGCCATCAGTGAAAGAGGCAAGCGGCGAAGATAGCCCGGTCGCCCCCAACATCAGCTCGGGGGCTACAAAGGCAGA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.00% | 8.20% | 0.80% | 0.00% | NA |
| All Indica | 2759 | 99.60% | 0.40% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 75.70% | 23.90% | 0.40% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.70% | 0.10% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 88.00% | 11.90% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 71.60% | 28.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 44.80% | 53.10% | 2.07% | 0.00% | NA |
| VI/Aromatic | 96 | 68.80% | 5.20% | 26.04% | 0.00% | NA |
| Intermediate | 90 | 84.40% | 8.90% | 6.67% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0619961711 | T -> C | LOC_Os06g34320.1 | 3_prime_UTR_variant ; 164.0bp to feature; MODIFIER | silent_mutation | Average:30.434; most accessible tissue: Zhenshan97 flag leaf, score: 45.537 | N | N | N | N |
| vg0619961711 | T -> C | LOC_Os06g34300.1 | upstream_gene_variant ; 4977.0bp to feature; MODIFIER | silent_mutation | Average:30.434; most accessible tissue: Zhenshan97 flag leaf, score: 45.537 | N | N | N | N |
| vg0619961711 | T -> C | LOC_Os06g34310.1 | downstream_gene_variant ; 579.0bp to feature; MODIFIER | silent_mutation | Average:30.434; most accessible tissue: Zhenshan97 flag leaf, score: 45.537 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0619961711 | 9.45E-06 | 1.67E-06 | mr1041 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619961711 | NA | 8.16E-06 | mr1192 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619961711 | NA | 9.63E-07 | mr1229 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619961711 | NA | 2.65E-06 | mr1293 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619961711 | NA | 8.57E-07 | mr1294 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619961711 | NA | 9.77E-09 | mr1302 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619961711 | NA | 7.67E-08 | mr1315 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619961711 | NA | 8.43E-07 | mr1392 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619961711 | NA | 4.16E-07 | mr1418 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619961711 | NA | 9.50E-07 | mr1420 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619961711 | NA | 5.86E-08 | mr1488 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619961711 | NA | 3.76E-08 | mr1506 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619961711 | NA | 2.84E-07 | mr1507 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619961711 | NA | 4.01E-07 | mr1596 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619961711 | 3.35E-07 | 3.34E-07 | mr1597 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619961711 | NA | 3.60E-09 | mr1604 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619961711 | NA | 1.27E-06 | mr1622 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619961711 | NA | 3.02E-07 | mr1677 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619961711 | NA | 4.96E-07 | mr1764 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619961711 | NA | 5.75E-07 | mr1809 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619961711 | NA | 5.39E-08 | mr1810 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619961711 | NA | 9.43E-07 | mr1886 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619961711 | NA | 7.53E-06 | mr1906 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |