\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0619955116:

Variant ID: vg0619955116 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 19955116
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGAAGCCTTCGGAAGAGTTCGGGTATGGCTCTAGTAACTTTCCTTTCCTCTTTTATAAGCTTTGTACTTTTATTAGAATACTCTTCTAAATACATTTATG[G/C]
TATTGGAATACTTTCTAAGTATATGAGTACCTACTTTACATTATGTTCATGTTATAATGAATATACGGCTAGCTTATCTGGGAGATGTTTTGGTGCGGGT

Reverse complement sequence

ACCCGCACCAAAACATCTCCCAGATAAGCTAGCCGTATATTCATTATAACATGAACATAATGTAAAGTAGGTACTCATATACTTAGAAAGTATTCCAATA[C/G]
CATAAATGTATTTAGAAGAGTATTCTAATAAAAGTACAAAGCTTATAAAAGAGGAAAGGAAAGTTACTAGAGCCATACCCGAACTCTTCCGAAGGCTTCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.70% 0.80% 6.71% 2.77% NA
All Indica  2759 84.90% 1.30% 10.69% 3.08% NA
All Japonica  1512 98.00% 0.10% 0.60% 1.32% NA
Aus  269 94.40% 0.00% 1.86% 3.72% NA
Indica I  595 76.10% 0.50% 20.34% 3.03% NA
Indica II  465 78.10% 2.20% 16.13% 3.66% NA
Indica III  913 93.40% 1.00% 1.97% 3.61% NA
Indica Intermediate  786 85.80% 1.80% 10.31% 2.16% NA
Temperate Japonica  767 99.20% 0.00% 0.39% 0.39% NA
Tropical Japonica  504 95.80% 0.00% 0.99% 3.17% NA
Japonica Intermediate  241 98.80% 0.40% 0.41% 0.41% NA
VI/Aromatic  96 85.40% 1.00% 3.12% 10.42% NA
Intermediate  90 86.70% 1.10% 5.56% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0619955116 G -> C LOC_Os06g34290.1 upstream_gene_variant ; 688.0bp to feature; MODIFIER silent_mutation Average:15.283; most accessible tissue: Zhenshan97 flower, score: 22.37 N N N N
vg0619955116 G -> C LOC_Os06g34310.1 upstream_gene_variant ; 1800.0bp to feature; MODIFIER silent_mutation Average:15.283; most accessible tissue: Zhenshan97 flower, score: 22.37 N N N N
vg0619955116 G -> C LOC_Os06g34280.1 downstream_gene_variant ; 4350.0bp to feature; MODIFIER silent_mutation Average:15.283; most accessible tissue: Zhenshan97 flower, score: 22.37 N N N N
vg0619955116 G -> C LOC_Os06g34300.1 downstream_gene_variant ; 693.0bp to feature; MODIFIER silent_mutation Average:15.283; most accessible tissue: Zhenshan97 flower, score: 22.37 N N N N
vg0619955116 G -> C LOC_Os06g34320.1 downstream_gene_variant ; 4359.0bp to feature; MODIFIER silent_mutation Average:15.283; most accessible tissue: Zhenshan97 flower, score: 22.37 N N N N
vg0619955116 G -> C LOC_Os06g34290-LOC_Os06g34300 intergenic_region ; MODIFIER silent_mutation Average:15.283; most accessible tissue: Zhenshan97 flower, score: 22.37 N N N N
vg0619955116 G -> DEL N N silent_mutation Average:15.283; most accessible tissue: Zhenshan97 flower, score: 22.37 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0619955116 3.29E-06 6.71E-06 mr1792 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251