\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0619934912:

Variant ID: vg0619934912 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 19934912
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGAGAAGCAGCCGATAGAGCTAAATTGATATGCTAAGACTAGATTAACAGAGACATATGATAAATAGGTAGGCAAATATATCATCCAAACCAGAGCAATC[T/C]
AAGAGGTCGAATGTACTGATGCAGCCTTGAACGACGCCGACGTAAACGATACAACTGCCCGGGCCGGCGGAACATTGGACTTACCCCTTAGCCAGAGATC

Reverse complement sequence

GATCTCTGGCTAAGGGGTAAGTCCAATGTTCCGCCGGCCCGGGCAGTTGTATCGTTTACGTCGGCGTCGTTCAAGGCTGCATCAGTACATTCGACCTCTT[A/G]
GATTGCTCTGGTTTGGATGATATATTTGCCTACCTATTTATCATATGTCTCTGTTAATCTAGTCTTAGCATATCAATTTAGCTCTATCGGCTGCTTCTCG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.00% 5.00% 12.82% 5.14% NA
All Indica  2759 77.20% 2.10% 15.19% 5.47% NA
All Japonica  1512 74.10% 10.10% 10.45% 5.29% NA
Aus  269 98.50% 0.70% 0.74% 0.00% NA
Indica I  595 63.90% 0.00% 25.88% 10.25% NA
Indica II  465 71.80% 0.60% 22.37% 5.16% NA
Indica III  913 87.10% 5.50% 4.71% 2.74% NA
Indica Intermediate  786 79.00% 0.80% 15.01% 5.22% NA
Temperate Japonica  767 85.50% 7.60% 5.74% 1.17% NA
Tropical Japonica  504 71.60% 10.70% 9.72% 7.94% NA
Japonica Intermediate  241 43.20% 17.00% 26.97% 12.86% NA
VI/Aromatic  96 65.60% 12.50% 12.50% 9.38% NA
Intermediate  90 68.90% 11.10% 16.67% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0619934912 T -> C LOC_Os06g34230.1 upstream_gene_variant ; 2836.0bp to feature; MODIFIER silent_mutation Average:17.745; most accessible tissue: Minghui63 root, score: 35.002 N N N N
vg0619934912 T -> C LOC_Os06g34240.1 upstream_gene_variant ; 606.0bp to feature; MODIFIER silent_mutation Average:17.745; most accessible tissue: Minghui63 root, score: 35.002 N N N N
vg0619934912 T -> C LOC_Os06g34250.1 downstream_gene_variant ; 4175.0bp to feature; MODIFIER silent_mutation Average:17.745; most accessible tissue: Minghui63 root, score: 35.002 N N N N
vg0619934912 T -> C LOC_Os06g34230-LOC_Os06g34240 intergenic_region ; MODIFIER silent_mutation Average:17.745; most accessible tissue: Minghui63 root, score: 35.002 N N N N
vg0619934912 T -> DEL N N silent_mutation Average:17.745; most accessible tissue: Minghui63 root, score: 35.002 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0619934912 NA 5.84E-06 mr1041 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619934912 NA 6.94E-06 mr1192 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619934912 NA 4.09E-07 mr1206 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619934912 NA 2.77E-06 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619934912 NA 1.31E-06 mr1293 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619934912 NA 2.21E-06 mr1294 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619934912 NA 9.77E-09 mr1302 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619934912 NA 1.96E-07 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619934912 NA 5.21E-06 mr1373 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619934912 NA 1.05E-06 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619934912 NA 3.84E-08 mr1418 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619934912 NA 3.07E-06 mr1419 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619934912 NA 2.92E-07 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619934912 8.94E-06 8.92E-06 mr1466 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619934912 NA 3.87E-08 mr1488 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619934912 NA 3.14E-06 mr1492 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619934912 NA 1.30E-08 mr1506 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619934912 NA 5.03E-07 mr1507 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619934912 NA 2.85E-07 mr1596 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619934912 NA 2.45E-06 mr1596 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619934912 4.67E-07 4.66E-07 mr1597 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619934912 NA 1.45E-08 mr1604 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619934912 NA 2.35E-07 mr1622 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619934912 NA 8.15E-07 mr1797 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619934912 NA 8.15E-07 mr1801 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619934912 8.62E-06 1.53E-07 mr1809 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619934912 NA 1.67E-08 mr1810 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619934912 NA 2.61E-06 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619934912 NA 7.35E-07 mr1886 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619934912 NA 7.42E-06 mr1906 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619934912 NA 3.22E-06 mr1960 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619934912 NA 7.32E-06 mr1992 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251