Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0619934912:

Variant ID: vg0619934912 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 19934912
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CGAGAAGCAGCCGATAGAGCTAAATTGATATGCTAAGACTAGATTAACAGAGACATATGATAAATAGGTAGGCAAATATATCATCCAAACCAGAGCAATC[T/C]
AAGAGGTCGAATGTACTGATGCAGCCTTGAACGACGCCGACGTAAACGATACAACTGCCCGGGCCGGCGGAACATTGGACTTACCCCTTAGCCAGAGATC

Reverse complement sequence

GATCTCTGGCTAAGGGGTAAGTCCAATGTTCCGCCGGCCCGGGCAGTTGTATCGTTTACGTCGGCGTCGTTCAAGGCTGCATCAGTACATTCGACCTCTT[A/G]
GATTGCTCTGGTTTGGATGATATATTTGCCTACCTATTTATCATATGTCTCTGTTAATCTAGTCTTAGCATATCAATTTAGCTCTATCGGCTGCTTCTCG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	77.00%	5.00%	12.82%	5.14%	NA
All Indica	2759	77.20%	2.10%	15.19%	5.47%	NA
All Japonica	1512	74.10%	10.10%	10.45%	5.29%	NA
Aus	269	98.50%	0.70%	0.74%	0.00%	NA
Indica I	595	63.90%	0.00%	25.88%	10.25%	NA
Indica II	465	71.80%	0.60%	22.37%	5.16%	NA
Indica III	913	87.10%	5.50%	4.71%	2.74%	NA
Indica Intermediate	786	79.00%	0.80%	15.01%	5.22%	NA
Temperate Japonica	767	85.50%	7.60%	5.74%	1.17%	NA
Tropical Japonica	504	71.60%	10.70%	9.72%	7.94%	NA
Japonica Intermediate	241	43.20%	17.00%	26.97%	12.86%	NA
VI/Aromatic	96	65.60%	12.50%	12.50%	9.38%	NA
Intermediate	90	68.90%	11.10%	16.67%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0619934912	T -> C	LOC_Os06g34230.1	upstream_gene_variant ; 2836.0bp to feature; MODIFIER	silent_mutation	Average:17.745; most accessible tissue: Minghui63 root, score: 35.002	N	N	N	N
vg0619934912	T -> C	LOC_Os06g34240.1	upstream_gene_variant ; 606.0bp to feature; MODIFIER	silent_mutation	Average:17.745; most accessible tissue: Minghui63 root, score: 35.002	N	N	N	N
vg0619934912	T -> C	LOC_Os06g34250.1	downstream_gene_variant ; 4175.0bp to feature; MODIFIER	silent_mutation	Average:17.745; most accessible tissue: Minghui63 root, score: 35.002	N	N	N	N
vg0619934912	T -> C	LOC_Os06g34230-LOC_Os06g34240	intergenic_region ; MODIFIER	silent_mutation	Average:17.745; most accessible tissue: Minghui63 root, score: 35.002	N	N	N	N
vg0619934912	T -> DEL	N	N	silent_mutation	Average:17.745; most accessible tissue: Minghui63 root, score: 35.002	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0619934912	NA	5.84E-06	mr1041	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619934912	NA	6.94E-06	mr1192	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619934912	NA	4.09E-07	mr1206	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619934912	NA	2.77E-06	mr1229	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619934912	NA	1.31E-06	mr1293	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619934912	NA	2.21E-06	mr1294	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619934912	NA	9.77E-09	mr1302	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619934912	NA	1.96E-07	mr1315	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619934912	NA	5.21E-06	mr1373	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619934912	NA	1.05E-06	mr1392	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619934912	NA	3.84E-08	mr1418	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619934912	NA	3.07E-06	mr1419	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619934912	NA	2.92E-07	mr1420	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619934912	8.94E-06	8.92E-06	mr1466	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619934912	NA	3.87E-08	mr1488	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619934912	NA	3.14E-06	mr1492	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619934912	NA	1.30E-08	mr1506	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619934912	NA	5.03E-07	mr1507	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619934912	NA	2.85E-07	mr1596	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619934912	NA	2.45E-06	mr1596	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619934912	4.67E-07	4.66E-07	mr1597	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619934912	NA	1.45E-08	mr1604	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619934912	NA	2.35E-07	mr1622	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619934912	NA	8.15E-07	mr1797	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619934912	NA	8.15E-07	mr1801	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619934912	8.62E-06	1.53E-07	mr1809	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619934912	NA	1.67E-08	mr1810	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619934912	NA	2.61E-06	mr1880	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619934912	NA	7.35E-07	mr1886	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619934912	NA	7.42E-06	mr1906	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619934912	NA	3.22E-06	mr1960	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619934912	NA	7.32E-06	mr1992	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251