\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0619932719:

Variant ID: vg0619932719 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 19932719
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.54, T: 0.47, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


CGGAGCAAACCGAGCACCAAACCAGGTCGCCATGACATGGTCACAACCAACTTTCGGCCCATTCATGGCGGCTCAGCAAGCATCACCAATCGGGGCCAGG[T/C]
AGCCAAATGAAATGGCCCAACCTCACGCACAAGCCGTCATTTTGCCCTTCGCCACGCCGTACCCGCAGCAAGGTGCCGTGAACAGGGCAGGGGGCGGAAA

Reverse complement sequence

TTTCCGCCCCCTGCCCTGTTCACGGCACCTTGCTGCGGGTACGGCGTGGCGAAGGGCAAAATGACGGCTTGTGCGTGAGGTTGGGCCATTTCATTTGGCT[A/G]
CCTGGCCCCGATTGGTGATGCTTGCTGAGCCGCCATGAATGGGCCGAAAGTTGGTTGTGACCATGTCATGGCGACCTGGTTTGGTGCTCGGTTTGCTCCG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 27.30% 10.40% 1.18% 61.13% NA
All Indica  2759 6.20% 2.40% 1.96% 89.45% NA
All Japonica  1512 71.40% 24.70% 0.00% 3.84% NA
Aus  269 0.70% 0.70% 0.37% 98.14% NA
Indica I  595 7.10% 0.00% 2.52% 90.42% NA
Indica II  465 8.00% 1.90% 1.94% 88.17% NA
Indica III  913 1.80% 5.60% 1.31% 91.35% NA
Indica Intermediate  786 9.70% 0.80% 2.29% 87.28% NA
Temperate Japonica  767 85.40% 12.00% 0.00% 2.61% NA
Tropical Japonica  504 64.50% 28.80% 0.00% 6.75% NA
Japonica Intermediate  241 41.50% 56.80% 0.00% 1.66% NA
VI/Aromatic  96 3.10% 33.30% 1.04% 62.50% NA
Intermediate  90 36.70% 20.00% 0.00% 43.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0619932719 T -> C LOC_Os06g34220.1 upstream_gene_variant ; 4001.0bp to feature; MODIFIER silent_mutation Average:7.081; most accessible tissue: Callus, score: 29.266 N N N N
vg0619932719 T -> C LOC_Os06g34230.1 upstream_gene_variant ; 643.0bp to feature; MODIFIER silent_mutation Average:7.081; most accessible tissue: Callus, score: 29.266 N N N N
vg0619932719 T -> C LOC_Os06g34240.1 upstream_gene_variant ; 2799.0bp to feature; MODIFIER silent_mutation Average:7.081; most accessible tissue: Callus, score: 29.266 N N N N
vg0619932719 T -> C LOC_Os06g34230-LOC_Os06g34240 intergenic_region ; MODIFIER silent_mutation Average:7.081; most accessible tissue: Callus, score: 29.266 N N N N
vg0619932719 T -> DEL N N silent_mutation Average:7.081; most accessible tissue: Callus, score: 29.266 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0619932719 NA 6.56E-06 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619932719 NA 1.20E-06 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619932719 NA 2.18E-06 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619932719 NA 8.57E-06 mr1290 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619932719 NA 1.73E-06 mr1293 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619932719 NA 4.71E-07 mr1294 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619932719 NA 1.13E-07 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619932719 NA 8.28E-06 mr1372 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619932719 NA 1.29E-06 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619932719 NA 8.24E-06 mr1393 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619932719 NA 3.01E-07 mr1418 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619932719 NA 1.32E-08 mr1506 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619932719 NA 1.53E-07 mr1507 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619932719 NA 1.98E-07 mr1596 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619932719 3.65E-08 3.64E-08 mr1597 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619932719 NA 4.87E-08 mr1604 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619932719 NA 7.87E-08 mr1622 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619932719 NA 1.07E-07 mr1680 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619932719 NA 6.40E-07 mr1809 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619932719 NA 3.23E-08 mr1810 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251