\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0619894434:

Variant ID: vg0619894434 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 19894434
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.80, A: 0.20, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


ATCCGGCCAACTCAATATTGTCAATACTGCCTAGAGGAGGTCCTTGGAGATTAAGCAGTCGATCCATCATTAGAGTTGAAGAAATTTCTCCTCGGCATTG[A/G]
ATCTTGTCAGCAAAGAATAAGCCGATTGGAAGTTGGCCTAATCCAAGTTGTCGAGCTGAACTCACAGGGTGATAGAATTCGTAAGAGACTTGGATATTTC

Reverse complement sequence

GAAATATCCAAGTCTCTTACGAATTCTATCACCCTGTGAGTTCAGCTCGACAACTTGGATTAGGCCAACTTCCAATCGGCTTATTCTTTGCTGACAAGAT[T/C]
CAATGCCGAGGAGAAATTTCTTCAACTCTAATGATGGATCGACTGCTTAATCTCCAAGGACCTCCTCTAGGCAGTATTGACAATATTGAGTTGGCCGGAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 28.50% 8.20% 3.60% 59.73% NA
All Indica  2759 4.60% 3.70% 5.80% 85.94% NA
All Japonica  1512 77.70% 18.30% 0.00% 3.97% NA
Aus  269 0.70% 0.40% 1.49% 97.40% NA
Indica I  595 4.20% 3.70% 3.70% 88.40% NA
Indica II  465 5.40% 5.40% 6.67% 82.58% NA
Indica III  913 2.30% 1.00% 4.93% 91.79% NA
Indica Intermediate  786 7.00% 5.90% 7.89% 79.26% NA
Temperate Japonica  767 69.60% 27.80% 0.00% 2.61% NA
Tropical Japonica  504 87.90% 5.60% 0.00% 6.55% NA
Japonica Intermediate  241 82.20% 14.90% 0.00% 2.90% NA
VI/Aromatic  96 2.10% 1.00% 4.17% 92.71% NA
Intermediate  90 44.40% 7.80% 2.22% 45.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0619894434 A -> G LOC_Os06g34150.1 synonymous_variant ; p.Ile386Ile; LOW synonymous_codon Average:8.744; most accessible tissue: Callus, score: 36.913 N N N N
vg0619894434 A -> DEL LOC_Os06g34150.1 N frameshift_variant Average:8.744; most accessible tissue: Callus, score: 36.913 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0619894434 NA 1.03E-06 mr1071 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619894434 NA 4.10E-06 mr1140 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619894434 NA 3.52E-06 mr1203 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619894434 3.64E-06 NA mr1108_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619894434 1.18E-06 1.44E-06 mr1114_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619894434 1.96E-06 6.29E-08 mr1117_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619894434 4.43E-06 6.34E-08 mr1119_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619894434 NA 4.30E-06 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619894434 NA 1.38E-07 mr1167_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619894434 4.46E-06 6.97E-06 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619894434 NA 4.15E-06 mr1878_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251