\
| Variant ID: vg0619892255 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 19892255 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 100. )
ATAGAAAATTCGGCAAGTGGTCGCCGAATTGGGAAGGACCGTTCCAGATTCATAAAGTAGTGTCTAAAGGGGCTTACATGCTGCAAGGACTCGATGGTGA[G/A]
GTTTATGGAAGAGCATTGAATGGCAAATACTTGAAGAAATATTATCCAAGTGTTTGGGTTAATGCATGATTGGCTGATGTTGCCAATACATGATAGCCGA
TCGGCTATCATGTATTGGCAACATCAGCCAATCATGCATTAACCCAAACACTTGGATAATATTTCTTCAAGTATTTGCCATTCAATGCTCTTCCATAAAC[C/T]
TCACCATCGAGTCCTTGCAGCATGTAAGCCCCTTTAGACACTACTTTATGAATCTGGAACGGTCCTTCCCAATTCGGCGACCACTTGCCGAATTTTCTAT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 34.60% | 33.80% | 1.25% | 30.28% | NA |
| All Indica | 2759 | 58.10% | 3.90% | 1.59% | 36.43% | NA |
| All Japonica | 1512 | 0.30% | 95.40% | 0.33% | 3.90% | NA |
| Aus | 269 | 1.10% | 0.40% | 0.00% | 98.51% | NA |
| Indica I | 595 | 47.40% | 2.90% | 1.85% | 47.90% | NA |
| Indica II | 465 | 68.80% | 4.50% | 1.29% | 25.38% | NA |
| Indica III | 913 | 63.60% | 1.60% | 0.99% | 33.73% | NA |
| Indica Intermediate | 786 | 53.40% | 6.90% | 2.29% | 37.40% | NA |
| Temperate Japonica | 767 | 0.40% | 97.10% | 0.00% | 2.48% | NA |
| Tropical Japonica | 504 | 0.20% | 92.30% | 0.79% | 6.75% | NA |
| Japonica Intermediate | 241 | 0.40% | 96.70% | 0.41% | 2.49% | NA |
| VI/Aromatic | 96 | 7.30% | 3.10% | 9.38% | 80.21% | NA |
| Intermediate | 90 | 21.10% | 50.00% | 1.11% | 27.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0619892255 | G -> A | LOC_Os06g34140.1 | synonymous_variant ; p.Glu1648Glu; LOW | synonymous_codon | Average:12.486; most accessible tissue: Callus, score: 31.68 | N | N | N | N |
| vg0619892255 | G -> DEL | LOC_Os06g34140.1 | N | frameshift_variant | Average:12.486; most accessible tissue: Callus, score: 31.68 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0619892255 | 4.20E-06 | 1.01E-09 | mr1033 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619892255 | NA | 1.22E-06 | mr1064 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619892255 | NA | 1.09E-07 | mr1103 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619892255 | 7.43E-06 | NA | mr1112 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619892255 | NA | 8.34E-08 | mr1176 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619892255 | NA | 1.53E-07 | mr1226 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619892255 | NA | 1.01E-17 | mr1253 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619892255 | NA | 4.58E-06 | mr1534 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619892255 | NA | 3.85E-06 | mr1560 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619892255 | NA | 3.73E-49 | mr1599 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619892255 | NA | 1.34E-09 | mr1663 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619892255 | NA | 1.24E-12 | mr1949 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619892255 | NA | 4.47E-06 | mr1970 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619892255 | 8.20E-09 | 4.20E-09 | mr1973 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619892255 | NA | 3.17E-22 | mr1949_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |