\
| Variant ID: vg0619888183 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 19888183 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 94. )
ATCAAAGATTGGGTCCAGTGAATCAAGATCATGGCCAAGAGGACAATGAAATCAGGAAAAATCAGTGGTGTCCTTCTGGTATTTTCACGAAGAATCAGAA[G/A]
AGAAGGGTTCAAAGATTGAGGAACAGGGAGCGATTTCAGGAGGTTGAACAGGAAATTAACCATCGGCTGAAGAGAACAAAGCCGAGGCAGGAGTGGCGCG
CGCGCCACTCCTGCCTCGGCTTTGTTCTCTTCAGCCGATGGTTAATTTCCTGTTCAACCTCCTGAAATCGCTCCCTGTTCCTCAATCTTTGAACCCTTCT[C/T]
TTCTGATTCTTCGTGAAAATACCAGAAGGACACCACTGATTTTTCCTGATTTCATTGTCCTCTTGGCCATGATCTTGATTCACTGGACCCAATCTTTGAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 36.20% | 9.20% | 12.48% | 42.04% | NA |
| All Indica | 2759 | 7.80% | 4.50% | 18.63% | 69.08% | NA |
| All Japonica | 1512 | 95.90% | 1.30% | 0.33% | 2.45% | NA |
| Aus | 269 | 0.40% | 98.90% | 0.37% | 0.37% | NA |
| Indica I | 595 | 3.40% | 0.20% | 17.82% | 78.66% | NA |
| Indica II | 465 | 8.00% | 3.20% | 18.92% | 69.89% | NA |
| Indica III | 913 | 9.60% | 4.10% | 19.39% | 66.92% | NA |
| Indica Intermediate | 786 | 9.00% | 8.90% | 18.19% | 63.87% | NA |
| Temperate Japonica | 767 | 97.10% | 0.00% | 0.26% | 2.61% | NA |
| Tropical Japonica | 504 | 93.50% | 4.00% | 0.20% | 2.38% | NA |
| Japonica Intermediate | 241 | 97.10% | 0.00% | 0.83% | 2.07% | NA |
| VI/Aromatic | 96 | 1.00% | 24.00% | 59.38% | 15.62% | NA |
| Intermediate | 90 | 50.00% | 4.40% | 14.44% | 31.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0619888183 | G -> A | LOC_Os06g34140.1 | synonymous_variant ; p.Lys538Lys; LOW | synonymous_codon | Average:9.516; most accessible tissue: Callus, score: 29.502 | N | N | N | N |
| vg0619888183 | G -> DEL | LOC_Os06g34140.1 | N | frameshift_variant | Average:9.516; most accessible tissue: Callus, score: 29.502 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0619888183 | NA | 8.61E-06 | mr1076 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619888183 | NA | 2.58E-06 | mr1082 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619888183 | NA | 1.53E-06 | mr1086 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619888183 | NA | 1.31E-20 | mr1102 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619888183 | NA | 7.14E-06 | mr1103 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619888183 | NA | 9.10E-07 | mr1145 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619888183 | NA | 9.41E-06 | mr1204 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619888183 | NA | 2.91E-07 | mr1226 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619888183 | NA | 5.16E-08 | mr1411 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619888183 | 2.34E-06 | 1.07E-23 | mr1805 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619888183 | 2.61E-06 | 1.95E-08 | mr1805 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619888183 | NA | 1.09E-06 | mr1878 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |