Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0619887922:

Variant ID: vg0619887922 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 19887922
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:

GTGCAAGGGGTTTTCAGGTGAATTCGGTTAAGATTATCAAGAAATATCTGAGGAAGTATGACAAGCAGCAGGATAAGTATCATGAAGAAGACGACGATGG[T/C]
TTTGATCCTCATTGGGGTTGTGAGTTCTTTAGATTCTGTTGGAATGAAGGTATGAGGCTGCCATCTATTGAAGACTGTCCTGGGTGTAGTGATATTGCCG

Reverse complement sequence

CGGCAATATCACTACACCCAGGACAGTCTTCAATAGATGGCAGCCTCATACCTTCATTCCAACAGAATCTAAAGAACTCACAACCCCAATGAGGATCAAA[A/G]
CCATCGTCGTCTTCTTCATGATACTTATCCTGCTGCTTGTCATACTTCCTCAGATATTTCTTGATAATCTTAACCGAATTCACCTGAAAACCCCTTGCAC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	35.40%	33.70%	26.01%	4.91%	NA
All Indica	2759	6.40%	47.30%	38.46%	7.87%	NA
All Japonica	1512	95.80%	0.90%	2.58%	0.73%	NA
Aus	269	0.00%	77.30%	22.68%	0.00%	NA
Indica I	595	1.70%	32.60%	51.60%	14.12%	NA
Indica II	465	6.20%	44.90%	37.42%	11.40%	NA
Indica III	913	8.40%	58.70%	31.87%	0.99%	NA
Indica Intermediate	786	7.80%	46.40%	36.77%	9.03%	NA
Temperate Japonica	767	97.00%	0.10%	2.48%	0.39%	NA
Tropical Japonica	504	93.50%	2.20%	2.98%	1.39%	NA
Japonica Intermediate	241	97.10%	0.40%	2.07%	0.41%	NA
VI/Aromatic	96	2.10%	50.00%	47.92%	0.00%	NA
Intermediate	90	48.90%	22.20%	24.44%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0619887922	T -> C	LOC_Os06g34140.1	synonymous_variant ; p.Gly461Gly; LOW	synonymous_codon	Average:13.295; most accessible tissue: Callus, score: 29.84	N	N	N	N
vg0619887922	T -> DEL	LOC_Os06g34140.1	N	frameshift_variant	Average:13.295; most accessible tissue: Callus, score: 29.84	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0619887922	NA	4.92E-27	mr1072	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619887922	NA	9.30E-20	mr1102	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619887922	NA	1.68E-11	mr1172	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619887922	NA	1.20E-07	mr1222	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619887922	NA	1.39E-26	mr1223	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619887922	NA	2.44E-07	mr1245	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619887922	NA	6.29E-08	mr1488	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619887922	NA	2.49E-07	mr1824	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619887922	NA	1.59E-06	mr1970	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619887922	NA	1.09E-08	mr1973	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619887922	NA	1.86E-07	mr1072_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619887922	NA	4.06E-08	mr1124_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619887922	NA	1.67E-10	mr1893_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619887922	5.63E-08	2.51E-11	mr1970_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619887922	1.84E-07	2.46E-12	mr1973_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251