\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0619887922:

Variant ID: vg0619887922 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 19887922
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


GTGCAAGGGGTTTTCAGGTGAATTCGGTTAAGATTATCAAGAAATATCTGAGGAAGTATGACAAGCAGCAGGATAAGTATCATGAAGAAGACGACGATGG[T/C]
TTTGATCCTCATTGGGGTTGTGAGTTCTTTAGATTCTGTTGGAATGAAGGTATGAGGCTGCCATCTATTGAAGACTGTCCTGGGTGTAGTGATATTGCCG

Reverse complement sequence

CGGCAATATCACTACACCCAGGACAGTCTTCAATAGATGGCAGCCTCATACCTTCATTCCAACAGAATCTAAAGAACTCACAACCCCAATGAGGATCAAA[A/G]
CCATCGTCGTCTTCTTCATGATACTTATCCTGCTGCTTGTCATACTTCCTCAGATATTTCTTGATAATCTTAACCGAATTCACCTGAAAACCCCTTGCAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 35.40% 33.70% 26.01% 4.91% NA
All Indica  2759 6.40% 47.30% 38.46% 7.87% NA
All Japonica  1512 95.80% 0.90% 2.58% 0.73% NA
Aus  269 0.00% 77.30% 22.68% 0.00% NA
Indica I  595 1.70% 32.60% 51.60% 14.12% NA
Indica II  465 6.20% 44.90% 37.42% 11.40% NA
Indica III  913 8.40% 58.70% 31.87% 0.99% NA
Indica Intermediate  786 7.80% 46.40% 36.77% 9.03% NA
Temperate Japonica  767 97.00% 0.10% 2.48% 0.39% NA
Tropical Japonica  504 93.50% 2.20% 2.98% 1.39% NA
Japonica Intermediate  241 97.10% 0.40% 2.07% 0.41% NA
VI/Aromatic  96 2.10% 50.00% 47.92% 0.00% NA
Intermediate  90 48.90% 22.20% 24.44% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0619887922 T -> C LOC_Os06g34140.1 synonymous_variant ; p.Gly461Gly; LOW synonymous_codon Average:13.295; most accessible tissue: Callus, score: 29.84 N N N N
vg0619887922 T -> DEL LOC_Os06g34140.1 N frameshift_variant Average:13.295; most accessible tissue: Callus, score: 29.84 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0619887922 NA 4.92E-27 mr1072 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619887922 NA 9.30E-20 mr1102 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619887922 NA 1.68E-11 mr1172 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619887922 NA 1.20E-07 mr1222 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619887922 NA 1.39E-26 mr1223 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619887922 NA 2.44E-07 mr1245 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619887922 NA 6.29E-08 mr1488 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619887922 NA 2.49E-07 mr1824 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619887922 NA 1.59E-06 mr1970 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619887922 NA 1.09E-08 mr1973 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619887922 NA 1.86E-07 mr1072_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619887922 NA 4.06E-08 mr1124_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619887922 NA 1.67E-10 mr1893_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619887922 5.63E-08 2.51E-11 mr1970_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619887922 1.84E-07 2.46E-12 mr1973_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251