\
| Variant ID: vg0619886817 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 19886817 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TGCCACAACAACCTCAAGGGACACCTCAACAGCGGCCATGGGCCGATTTGATTGCAGATGTCATGAAGGAGCAGTTCGGGCTCAGGCCGAAAGATGTTGG[G/A]
AATCTATATCGATAGCCATATCCTGAATTGTTTGAGAGAGTTCCTTTACCTAACCGGTTCAAAGTTCCAAATTTTTCAAAGTTCTCAGGGCAAGATAGTA
TACTATCTTGCCCTGAGAACTTTGAAAAATTTGGAACTTTGAACCGGTTAGGTAAAGGAACTCTCTCAAACAATTCAGGATATGGCTATCGATATAGATT[C/T]
CCAACATCTTTCGGCCTGAGCCCGAACTGCTCCTTCATGACATCTGCAATCAAATCGGCCCATGGCCGCTGTTGAGGTGTCCCTTGAGGTTGTTGTGGCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 34.00% | 0.20% | 1.82% | 64.01% | NA |
| All Indica | 2759 | 4.10% | 0.30% | 1.09% | 94.56% | NA |
| All Japonica | 1512 | 95.90% | 0.00% | 0.13% | 3.97% | NA |
| Aus | 269 | 0.00% | 0.00% | 0.00% | 100.00% | NA |
| Indica I | 595 | 2.70% | 0.50% | 1.01% | 95.80% | NA |
| Indica II | 465 | 5.20% | 0.20% | 0.43% | 94.19% | NA |
| Indica III | 913 | 2.00% | 0.30% | 1.53% | 96.17% | NA |
| Indica Intermediate | 786 | 6.90% | 0.10% | 1.02% | 91.98% | NA |
| Temperate Japonica | 767 | 97.10% | 0.00% | 0.00% | 2.87% | NA |
| Tropical Japonica | 504 | 93.50% | 0.00% | 0.00% | 6.55% | NA |
| Japonica Intermediate | 241 | 97.10% | 0.00% | 0.83% | 2.07% | NA |
| VI/Aromatic | 96 | 1.00% | 0.00% | 51.04% | 47.92% | NA |
| Intermediate | 90 | 48.90% | 0.00% | 5.56% | 45.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0619886817 | G -> A | LOC_Os06g34140.1 | intron_variant ; MODIFIER | silent_mutation | Average:14.436; most accessible tissue: Callus, score: 33.431 | N | N | N | N |
| vg0619886817 | G -> DEL | N | N | silent_mutation | Average:14.436; most accessible tissue: Callus, score: 33.431 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0619886817 | NA | 1.47E-07 | mr1145 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619886817 | NA | 2.86E-08 | mr1241 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619886817 | NA | 3.08E-08 | mr1301 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619886817 | NA | 3.77E-07 | mr1411 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619886817 | NA | 8.82E-06 | mr1436 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619886817 | NA | 6.52E-06 | mr1437 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619886817 | NA | 4.32E-09 | mr1722 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619886817 | NA | 6.29E-06 | mr1805 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619886817 | NA | 3.61E-08 | mr1973 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619886817 | NA | 9.32E-07 | mr1970_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619886817 | NA | 1.30E-07 | mr1973_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |