\
| Variant ID: vg0619886632 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 19886632 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 94. )
AGATGGCACAATTATTCCTCAAGTTATTCCTGAACATTTGGTGCGTAATATTCAGCCAGACCTTCAAAATTACCAAGGGGGCAATTTGAATTATCAATAT[C/T]
AGCCACCATCGCCTCATGTTCAGTACCAGCAGGCAGGATCGGCTCAACCCCAATTTGTCCCTCACTACAATCAATTTGAGCCTATGCCACAACAACCTCA
TGAGGTTGTTGTGGCATAGGCTCAAATTGATTGTAGTGAGGGACAAATTGGGGTTGAGCCGATCCTGCCTGCTGGTACTGAACATGAGGCGATGGTGGCT[G/A]
ATATTGATAATTCAAATTGCCCCCTTGGTAATTTTGAAGGTCTGGCTGAATATTACGCACCAAATGTTCAGGAATAACTTGAGGAATAATTGTGCCATCT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 36.40% | 0.40% | 1.52% | 61.74% | NA |
| All Indica | 2759 | 7.80% | 0.40% | 1.20% | 90.65% | NA |
| All Japonica | 1512 | 96.00% | 0.10% | 0.26% | 3.70% | NA |
| Aus | 269 | 1.90% | 1.10% | 0.37% | 96.65% | NA |
| Indica I | 595 | 2.50% | 0.20% | 1.68% | 95.63% | NA |
| Indica II | 465 | 7.70% | 0.60% | 0.65% | 90.97% | NA |
| Indica III | 913 | 10.60% | 0.40% | 1.20% | 87.73% | NA |
| Indica Intermediate | 786 | 8.50% | 0.30% | 1.15% | 90.08% | NA |
| Temperate Japonica | 767 | 97.10% | 0.10% | 0.13% | 2.61% | NA |
| Tropical Japonica | 504 | 93.70% | 0.00% | 0.20% | 6.15% | NA |
| Japonica Intermediate | 241 | 97.10% | 0.00% | 0.83% | 2.07% | NA |
| VI/Aromatic | 96 | 3.10% | 2.10% | 29.17% | 65.62% | NA |
| Intermediate | 90 | 50.00% | 1.10% | 6.67% | 42.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0619886632 | C -> T | LOC_Os06g34140.1 | intron_variant ; MODIFIER | silent_mutation | Average:13.666; most accessible tissue: Callus, score: 21.393 | N | N | N | N |
| vg0619886632 | C -> DEL | N | N | silent_mutation | Average:13.666; most accessible tissue: Callus, score: 21.393 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0619886632 | NA | 3.47E-07 | mr1408_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619886632 | NA | 7.64E-06 | mr1482_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619886632 | NA | 2.11E-06 | mr1691_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619886632 | NA | 1.05E-06 | mr1727_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619886632 | 8.24E-06 | NA | mr1743_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619886632 | 6.74E-07 | 1.01E-06 | mr1743_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619886632 | NA | 1.04E-06 | mr1866_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619886632 | NA | 2.65E-06 | mr1915_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619886632 | NA | 6.14E-09 | mr1947_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619886632 | 8.02E-06 | 8.02E-06 | mr1947_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619886632 | 6.81E-06 | 1.48E-06 | mr1986_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |