\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0619863366:

Variant ID: vg0619863366 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 19863366
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 81. )

Flanking Sequence (100 bp) in Reference Genome:


AATTCCAATTATTTCTAGATTGTATTCCTACATGGAATCTTCTTTTTCCAATTTCAGATTTTATTTTATTTTAATTTCGAATTTTAATTAATCTCGTATT[G/A]
GATTCTTATACGAGCTCTTTTTTCAATATTGCTTATTTGTAATTCCGAATTTCAGCTATTTTTAAATTGTATTTCTACTTAGACTTTTTTTTTCTCCGAT

Reverse complement sequence

ATCGGAGAAAAAAAAAGTCTAAGTAGAAATACAATTTAAAAATAGCTGAAATTCGGAATTACAAATAAGCAATATTGAAAAAAGAGCTCGTATAAGAATC[C/T]
AATACGAGATTAATTAAAATTCGAAATTAAAATAAAATAAAATCTGAAATTGGAAAAAGAAGATTCCATGTAGGAATACAATCTAGAAATAATTGGAATT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 43.90% 29.30% 1.71% 25.16% NA
All Indica  2759 8.80% 48.00% 2.68% 40.49% NA
All Japonica  1512 96.90% 1.90% 0.07% 1.12% NA
Aus  269 98.10% 0.70% 0.37% 0.74% NA
Indica I  595 2.20% 73.40% 0.67% 23.70% NA
Indica II  465 8.40% 65.60% 1.29% 24.73% NA
Indica III  913 7.80% 24.00% 3.83% 64.40% NA
Indica Intermediate  786 15.40% 46.20% 3.69% 34.73% NA
Temperate Japonica  767 96.70% 1.60% 0.00% 1.69% NA
Tropical Japonica  504 97.00% 2.80% 0.20% 0.00% NA
Japonica Intermediate  241 97.10% 1.20% 0.00% 1.66% NA
VI/Aromatic  96 54.20% 6.20% 1.04% 38.54% NA
Intermediate  90 53.30% 24.40% 4.44% 17.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0619863366 G -> A LOC_Os06g34110.1 downstream_gene_variant ; 2494.0bp to feature; MODIFIER silent_mutation Average:14.999; most accessible tissue: Zhenshan97 panicle, score: 39.652 N N N N
vg0619863366 G -> A LOC_Os06g34120.1 downstream_gene_variant ; 2704.0bp to feature; MODIFIER silent_mutation Average:14.999; most accessible tissue: Zhenshan97 panicle, score: 39.652 N N N N
vg0619863366 G -> A LOC_Os06g34110-LOC_Os06g34120 intergenic_region ; MODIFIER silent_mutation Average:14.999; most accessible tissue: Zhenshan97 panicle, score: 39.652 N N N N
vg0619863366 G -> DEL N N silent_mutation Average:14.999; most accessible tissue: Zhenshan97 panicle, score: 39.652 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0619863366 NA 5.07E-06 mr1197 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619863366 NA 2.15E-07 mr1623_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619863366 4.55E-07 3.82E-26 mr1877_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619863366 1.67E-06 1.34E-09 mr1877_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251