\
| Variant ID: vg0619863366 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 19863366 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 81. )
AATTCCAATTATTTCTAGATTGTATTCCTACATGGAATCTTCTTTTTCCAATTTCAGATTTTATTTTATTTTAATTTCGAATTTTAATTAATCTCGTATT[G/A]
GATTCTTATACGAGCTCTTTTTTCAATATTGCTTATTTGTAATTCCGAATTTCAGCTATTTTTAAATTGTATTTCTACTTAGACTTTTTTTTTCTCCGAT
ATCGGAGAAAAAAAAAGTCTAAGTAGAAATACAATTTAAAAATAGCTGAAATTCGGAATTACAAATAAGCAATATTGAAAAAAGAGCTCGTATAAGAATC[C/T]
AATACGAGATTAATTAAAATTCGAAATTAAAATAAAATAAAATCTGAAATTGGAAAAAGAAGATTCCATGTAGGAATACAATCTAGAAATAATTGGAATT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 43.90% | 29.30% | 1.71% | 25.16% | NA |
| All Indica | 2759 | 8.80% | 48.00% | 2.68% | 40.49% | NA |
| All Japonica | 1512 | 96.90% | 1.90% | 0.07% | 1.12% | NA |
| Aus | 269 | 98.10% | 0.70% | 0.37% | 0.74% | NA |
| Indica I | 595 | 2.20% | 73.40% | 0.67% | 23.70% | NA |
| Indica II | 465 | 8.40% | 65.60% | 1.29% | 24.73% | NA |
| Indica III | 913 | 7.80% | 24.00% | 3.83% | 64.40% | NA |
| Indica Intermediate | 786 | 15.40% | 46.20% | 3.69% | 34.73% | NA |
| Temperate Japonica | 767 | 96.70% | 1.60% | 0.00% | 1.69% | NA |
| Tropical Japonica | 504 | 97.00% | 2.80% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.10% | 1.20% | 0.00% | 1.66% | NA |
| VI/Aromatic | 96 | 54.20% | 6.20% | 1.04% | 38.54% | NA |
| Intermediate | 90 | 53.30% | 24.40% | 4.44% | 17.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0619863366 | G -> A | LOC_Os06g34110.1 | downstream_gene_variant ; 2494.0bp to feature; MODIFIER | silent_mutation | Average:14.999; most accessible tissue: Zhenshan97 panicle, score: 39.652 | N | N | N | N |
| vg0619863366 | G -> A | LOC_Os06g34120.1 | downstream_gene_variant ; 2704.0bp to feature; MODIFIER | silent_mutation | Average:14.999; most accessible tissue: Zhenshan97 panicle, score: 39.652 | N | N | N | N |
| vg0619863366 | G -> A | LOC_Os06g34110-LOC_Os06g34120 | intergenic_region ; MODIFIER | silent_mutation | Average:14.999; most accessible tissue: Zhenshan97 panicle, score: 39.652 | N | N | N | N |
| vg0619863366 | G -> DEL | N | N | silent_mutation | Average:14.999; most accessible tissue: Zhenshan97 panicle, score: 39.652 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0619863366 | NA | 5.07E-06 | mr1197 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619863366 | NA | 2.15E-07 | mr1623_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619863366 | 4.55E-07 | 3.82E-26 | mr1877_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619863366 | 1.67E-06 | 1.34E-09 | mr1877_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |