Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0619861018:

Variant ID: vg0619861018 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 19861018
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, G: 0.01, others allele: 0.00, population size: 81. )

Flanking Sequence (100 bp) in Reference Genome:

ATGTAAAACTCAACATTTGTAATTTGCCTTTTTGTCATTTGCCTGTGTTCGGTGAAATCCTTCTTTCTTTCTTCTTCTTTCTTTTGAGAGAATCCATTAT[A/G]
TACCACTAACTTTGTCATACGTCTACGATTTGCCACCGACTTTGTCACGTTCTACAATATGCTATTGACTTTTGCTTAACTTCTACGATTTACTATCGTC

Reverse complement sequence

GACGATAGTAAATCGTAGAAGTTAAGCAAAAGTCAATAGCATATTGTAGAACGTGACAAAGTCGGTGGCAAATCGTAGACGTATGACAAAGTTAGTGGTA[T/C]
ATAATGGATTCTCTCAAAAGAAAGAAGAAGAAAGAAAGAAGGATTTCACCGAACACAGGCAAATGACAAAAAGGCAAATTACAAATGTTGAGTTTTACAT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	43.70%	29.30%	1.74%	25.29%	NA
All Indica	2759	8.40%	48.10%	2.83%	40.63%	NA
All Japonica	1512	97.00%	1.90%	0.00%	1.19%	NA
Aus	269	98.90%	0.00%	0.37%	0.74%	NA
Indica I	595	1.70%	74.10%	1.18%	23.03%	NA
Indica II	465	8.00%	65.80%	1.08%	25.16%	NA
Indica III	913	7.60%	24.10%	4.49%	63.86%	NA
Indica Intermediate	786	14.80%	45.90%	3.18%	36.13%	NA
Temperate Japonica	767	96.70%	1.60%	0.00%	1.69%	NA
Tropical Japonica	504	97.20%	2.60%	0.00%	0.20%	NA
Japonica Intermediate	241	97.10%	1.20%	0.00%	1.66%	NA
VI/Aromatic	96	54.20%	6.20%	0.00%	39.58%	NA
Intermediate	90	54.40%	24.40%	3.33%	17.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0619861018	A -> G	LOC_Os06g34100.1	downstream_gene_variant ; 4483.0bp to feature; MODIFIER	silent_mutation	Average:39.976; most accessible tissue: Callus, score: 83.689	N	N	N	N
vg0619861018	A -> G	LOC_Os06g34110.1	downstream_gene_variant ; 146.0bp to feature; MODIFIER	silent_mutation	Average:39.976; most accessible tissue: Callus, score: 83.689	N	N	N	N
vg0619861018	A -> G	LOC_Os06g34110-LOC_Os06g34120	intergenic_region ; MODIFIER	silent_mutation	Average:39.976; most accessible tissue: Callus, score: 83.689	N	N	N	N
vg0619861018	A -> DEL	N	N	silent_mutation	Average:39.976; most accessible tissue: Callus, score: 83.689	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0619861018	NA	3.72E-06	mr1197	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619861018	2.58E-06	1.31E-26	mr1877_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619861018	NA	1.62E-09	mr1877_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251