\
| Variant ID: vg0619826206 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 19826206 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 309. )
TGACAGTAGCTACTAGGATTTATCTTTAATCATGTGCTAAATCCTTAACAAACATAAATCCCAACTCACATCCCTCCTATCATATTATTAATCCAGCTAG[A/G]
CATACTATATTTCATCCAACAAACTCTTGAAAGTAACCGACAAACTACATGCATCACTACCCAGCCCTCATCTTAAATCTATCAAATCTAGGGATTTAGC
GCTAAATCCCTAGATTTGATAGATTTAAGATGAGGGCTGGGTAGTGATGCATGTAGTTTGTCGGTTACTTTCAAGAGTTTGTTGGATGAAATATAGTATG[T/C]
CTAGCTGGATTAATAATATGATAGGAGGGATGTGAGTTGGGATTTATGTTTGTTAAGGATTTAGCACATGATTAAAGATAAATCCTAGTAGCTACTGTCA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.60% | 4.20% | 0.17% | 0.00% | NA |
| All Indica | 2759 | 92.50% | 7.20% | 0.29% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 86.90% | 12.60% | 0.50% | 0.00% | NA |
| Indica II | 465 | 97.40% | 2.40% | 0.22% | 0.00% | NA |
| Indica III | 913 | 94.20% | 5.80% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 92.00% | 7.50% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0619826206 | A -> G | LOC_Os06g34040.1 | intron_variant ; MODIFIER | silent_mutation | Average:45.864; most accessible tissue: Callus, score: 66.935 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0619826206 | NA | 4.78E-07 | mr1095 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619826206 | NA | 6.62E-08 | mr1098 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619826206 | NA | 7.40E-09 | mr1180 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619826206 | NA | 1.09E-08 | mr1183 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619826206 | NA | 7.48E-09 | mr1503 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619826206 | 3.06E-06 | 4.74E-08 | mr1064_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619826206 | NA | 5.11E-08 | mr1095_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619826206 | NA | 4.35E-10 | mr1098_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619826206 | NA | 4.88E-07 | mr1099_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619826206 | NA | 8.10E-09 | mr1180_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619826206 | NA | 1.29E-07 | mr1911_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |