Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0619807728:

Variant ID: vg0619807728 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 19807728
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.02, others allele: 0.00, population size: 300. )

Flanking Sequence (100 bp) in Reference Genome:

TGTTCCATATGCTTCAGATCATTACGTGCTTCCAGTGTATCTTTCAACTTTCCGTATACACCTAGGAAGCCAAGAAGGTTTACGCAAAGTTCTTAGTGAG[G/A]
TGCATCACGTCGATTGCGTGGCGTACGTTCAAGAATTCCCAATATGGTAACTCCCAAAATATAGAGTTCTTTTTCCACATCGCCGCGTGACCATCTTCGC

Reverse complement sequence

GCGAAGATGGTCACGCGGCGATGTGGAAAAAGAACTCTATATTTTGGGAGTTACCATATTGGGAATTCTTGAACGTACGCCACGCAATCGACGTGATGCA[C/T]
CTCACTAAGAACTTTGCGTAAACCTTCTTGGCTTCCTAGGTGTATACGGAAAGTTGAAAGATACACTGGAAGCACGTAATGATCTGAAGCATATGGAACA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	72.30%	27.70%	0.04%	0.00%	NA
All Indica	2759	53.80%	46.10%	0.07%	0.00%	NA
All Japonica	1512	98.90%	1.10%	0.00%	0.00%	NA
Aus	269	98.90%	1.10%	0.00%	0.00%	NA
Indica I	595	77.50%	22.40%	0.17%	0.00%	NA
Indica II	465	72.70%	27.30%	0.00%	0.00%	NA
Indica III	913	27.10%	72.80%	0.11%	0.00%	NA
Indica Intermediate	786	55.90%	44.10%	0.00%	0.00%	NA
Temperate Japonica	767	97.90%	2.10%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	82.20%	17.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0619807728	G -> A	LOC_Os06g34000.1	upstream_gene_variant ; 4437.0bp to feature; MODIFIER	silent_mutation	Average:20.279; most accessible tissue: Zhenshan97 root, score: 29.203	N	N	N	N
vg0619807728	G -> A	LOC_Os06g34010.1	intron_variant ; MODIFIER	silent_mutation	Average:20.279; most accessible tissue: Zhenshan97 root, score: 29.203	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0619807728	NA	1.22E-09	mr1091	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619807728	NA	7.92E-06	mr1002_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619807728	NA	4.44E-12	mr1091_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619807728	NA	2.08E-08	mr1112_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619807728	NA	1.37E-06	mr1133_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619807728	NA	4.76E-09	mr1221_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619807728	NA	5.29E-06	mr1346_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619807728	NA	9.03E-13	mr1349_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619807728	NA	1.16E-07	mr1349_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619807728	NA	3.79E-06	mr1428_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619807728	NA	2.12E-06	mr1452_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619807728	NA	1.77E-06	mr1452_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619807728	NA	2.52E-06	mr1483_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619807728	NA	1.02E-06	mr1483_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619807728	NA	1.13E-07	mr1530_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619807728	NA	1.67E-08	mr1540_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619807728	NA	6.86E-08	mr1582_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619807728	NA	2.62E-11	mr1667_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619807728	NA	8.48E-08	mr1667_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619807728	NA	4.05E-08	mr1732_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619807728	NA	9.19E-07	mr1734_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619807728	NA	3.00E-06	mr1879_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251