Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0619807728:

Variant ID: vg0619807728 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 19807728
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.02, others allele: 0.00, population size: 300. )

Flanking Sequence (100 bp) in Reference Genome:


TGTTCCATATGCTTCAGATCATTACGTGCTTCCAGTGTATCTTTCAACTTTCCGTATACACCTAGGAAGCCAAGAAGGTTTACGCAAAGTTCTTAGTGAG[G/A]
TGCATCACGTCGATTGCGTGGCGTACGTTCAAGAATTCCCAATATGGTAACTCCCAAAATATAGAGTTCTTTTTCCACATCGCCGCGTGACCATCTTCGC

Reverse complement sequence

GCGAAGATGGTCACGCGGCGATGTGGAAAAAGAACTCTATATTTTGGGAGTTACCATATTGGGAATTCTTGAACGTACGCCACGCAATCGACGTGATGCA[C/T]
CTCACTAAGAACTTTGCGTAAACCTTCTTGGCTTCCTAGGTGTATACGGAAAGTTGAAAGATACACTGGAAGCACGTAATGATCTGAAGCATATGGAACA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.30% 27.70% 0.04% 0.00% NA
All Indica  2759 53.80% 46.10% 0.07% 0.00% NA
All Japonica  1512 98.90% 1.10% 0.00% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 77.50% 22.40% 0.17% 0.00% NA
Indica II  465 72.70% 27.30% 0.00% 0.00% NA
Indica III  913 27.10% 72.80% 0.11% 0.00% NA
Indica Intermediate  786 55.90% 44.10% 0.00% 0.00% NA
Temperate Japonica  767 97.90% 2.10% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 82.20% 17.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0619807728 G -> A LOC_Os06g34000.1 upstream_gene_variant ; 4437.0bp to feature; MODIFIER silent_mutation Average:20.279; most accessible tissue: Zhenshan97 root, score: 29.203 N N N N
vg0619807728 G -> A LOC_Os06g34010.1 intron_variant ; MODIFIER silent_mutation Average:20.279; most accessible tissue: Zhenshan97 root, score: 29.203 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0619807728 NA 1.22E-09 mr1091 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619807728 NA 7.92E-06 mr1002_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619807728 NA 4.44E-12 mr1091_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619807728 NA 2.08E-08 mr1112_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619807728 NA 1.37E-06 mr1133_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619807728 NA 4.76E-09 mr1221_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619807728 NA 5.29E-06 mr1346_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619807728 NA 9.03E-13 mr1349_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619807728 NA 1.16E-07 mr1349_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619807728 NA 3.79E-06 mr1428_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619807728 NA 2.12E-06 mr1452_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619807728 NA 1.77E-06 mr1452_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619807728 NA 2.52E-06 mr1483_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619807728 NA 1.02E-06 mr1483_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619807728 NA 1.13E-07 mr1530_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619807728 NA 1.67E-08 mr1540_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619807728 NA 6.86E-08 mr1582_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619807728 NA 2.62E-11 mr1667_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619807728 NA 8.48E-08 mr1667_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619807728 NA 4.05E-08 mr1732_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619807728 NA 9.19E-07 mr1734_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619807728 NA 3.00E-06 mr1879_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251