\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0619806653:

Variant ID: vg0619806653 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 19806653
Reference Allele: AAlternative Allele: G,C
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.72, A: 0.29, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


TTCGATGGCACCGTAATACGTGGCAGTTGTTCCATCGTGTCCCATGGCATCGACACGAACAGCGCTGTTTTGGTTCGTGCTCTTCATGTCTTAGGCTCTC[A/G,C]
TGTAGAATGTATACCCATTGATCTCATATCCCTGGAATGTCGCGATCGACCCAGACGGTCCCCTCGCCAGGAAGGCAAGTTGTTGGTTGATCGACTCGTT

Reverse complement sequence

AACGAGTCGATCAACCAACAACTTGCCTTCCTGGCGAGGGGACCGTCTGGGTCGATCGCGACATTCCAGGGATATGAGATCAATGGGTATACATTCTACA[T/C,G]
GAGAGCCTAAGACATGAAGAGCACGAACCAAAACAGCGCTGTTCGTGTCGATGCCATGGGACACGATGGAACAACTGCCACGTATTACGGTGCCATCGAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.60% 33.00% 0.42% 0.00% C: 0.02%
All Indica  2759 95.90% 3.70% 0.33% 0.00% NA
All Japonica  1512 6.30% 93.50% 0.20% 0.00% NA
Aus  269 96.70% 1.90% 1.12% 0.00% C: 0.37%
Indica I  595 97.50% 2.00% 0.50% 0.00% NA
Indica II  465 95.10% 4.50% 0.43% 0.00% NA
Indica III  913 97.70% 2.10% 0.22% 0.00% NA
Indica Intermediate  786 93.30% 6.50% 0.25% 0.00% NA
Temperate Japonica  767 3.40% 96.50% 0.13% 0.00% NA
Tropical Japonica  504 11.90% 88.10% 0.00% 0.00% NA
Japonica Intermediate  241 3.70% 95.40% 0.83% 0.00% NA
VI/Aromatic  96 97.90% 1.00% 1.04% 0.00% NA
Intermediate  90 55.60% 40.00% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0619806653 A -> C LOC_Os06g34000.1 upstream_gene_variant ; 3362.0bp to feature; MODIFIER silent_mutation Average:24.711; most accessible tissue: Minghui63 young leaf, score: 43.347 N N N N
vg0619806653 A -> C LOC_Os06g34010.1 intron_variant ; MODIFIER silent_mutation Average:24.711; most accessible tissue: Minghui63 young leaf, score: 43.347 N N N N
vg0619806653 A -> G LOC_Os06g34000.1 upstream_gene_variant ; 3362.0bp to feature; MODIFIER silent_mutation Average:24.711; most accessible tissue: Minghui63 young leaf, score: 43.347 N N N N
vg0619806653 A -> G LOC_Os06g34010.1 intron_variant ; MODIFIER silent_mutation Average:24.711; most accessible tissue: Minghui63 young leaf, score: 43.347 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0619806653 NA 1.02E-06 mr1111_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619806653 NA 1.43E-07 mr1144_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619806653 NA 3.61E-14 mr1216_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251