\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0619763326:

Variant ID: vg0619763326 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 19763326
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:


TTTAGAAAAACATGAGCTGCAATTAGAAATCTGATCGACTCAAGTTAGCATGCGAATTTTTTTTTAAAAAAATATTTCTTATACGACTCTTTCTATACTT[C/T]
CAAAAACGAATGAACTTAAGAACTGACTCAAATACGGATATGTATTTCAAAAGCAAACGAACTTAAAAACCGAGTCATATACGGATGACTTACCAAAGTG

Reverse complement sequence

CACTTTGGTAAGTCATCCGTATATGACTCGGTTTTTAAGTTCGTTTGCTTTTGAAATACATATCCGTATTTGAGTCAGTTCTTAAGTTCATTCGTTTTTG[G/A]
AAGTATAGAAAGAGTCGTATAAGAAATATTTTTTTAAAAAAAAATTCGCATGCTAACTTGAGTCGATCAGATTTCTAATTGCAGCTCATGTTTTTCTAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.10% 41.80% 0.15% 0.00% NA
All Indica  2759 40.50% 59.30% 0.14% 0.00% NA
All Japonica  1512 97.40% 2.60% 0.07% 0.00% NA
Aus  269 1.10% 98.50% 0.37% 0.00% NA
Indica I  595 8.70% 91.30% 0.00% 0.00% NA
Indica II  465 28.80% 70.80% 0.43% 0.00% NA
Indica III  913 67.30% 32.70% 0.00% 0.00% NA
Indica Intermediate  786 40.50% 59.30% 0.25% 0.00% NA
Temperate Japonica  767 98.40% 1.40% 0.13% 0.00% NA
Tropical Japonica  504 94.80% 5.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 91.70% 8.30% 0.00% 0.00% NA
Intermediate  90 70.00% 28.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0619763326 C -> T LOC_Os06g33940-LOC_Os06g33950 intergenic_region ; MODIFIER silent_mutation Average:25.019; most accessible tissue: Zhenshan97 young leaf, score: 37.835 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0619763326 NA 1.25E-07 mr1087 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619763326 NA 4.28E-17 mr1118 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619763326 NA 1.31E-19 mr1242 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619763326 NA 6.47E-06 mr1242 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619763326 NA 5.13E-23 mr1495 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619763326 NA 1.41E-06 mr1526 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619763326 NA 2.91E-11 mr1609 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619763326 NA 6.28E-08 mr1078_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619763326 NA 2.45E-10 mr1087_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619763326 NA 9.36E-18 mr1118_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619763326 NA 1.91E-06 mr1144_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619763326 NA 1.81E-11 mr1216_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619763326 NA 5.97E-11 mr1234_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619763326 NA 1.57E-15 mr1333_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619763326 NA 3.18E-22 mr1495_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619763326 NA 1.49E-08 mr1526_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619763326 NA 6.62E-07 mr1582_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619763326 NA 5.49E-10 mr1623_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619763326 NA 6.19E-07 mr1623_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619763326 NA 4.37E-06 mr1667_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619763326 NA 1.58E-06 mr1879_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251