\
| Variant ID: vg0619755654 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 19755654 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.00, others allele: 0.00, population size: 227. )
TAACCTTAAATTTGGAGCTGATTTTGTGTTTTTTTCATAGAAGTTTATTTTTCAGCCTTTGCTTTTAGATCGCTAAGAACACATATATAAAAGTTGTATT[T/C]
ATAAATTACTTTTCATTTGCAAATATGTCATTTCGCTTATTTCGCGAATAAGCGAAACAATGGCTCCTGTAGTTTTCAGCGTATATTTTCCCTGCTAAGC
GCTTAGCAGGGAAAATATACGCTGAAAACTACAGGAGCCATTGTTTCGCTTATTCGCGAAATAAGCGAAATGACATATTTGCAAATGAAAAGTAATTTAT[A/G]
AATACAACTTTTATATATGTGTTCTTAGCGATCTAAAAGCAAAGGCTGAAAAATAAACTTCTATGAAAAAAACACAAAATCAGCTCCAAATTTAAGGTTA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 50.40% | 49.20% | 0.38% | 0.00% | NA |
| All Indica | 2759 | 60.60% | 39.10% | 0.33% | 0.00% | NA |
| All Japonica | 1512 | 20.70% | 78.90% | 0.40% | 0.00% | NA |
| Aus | 269 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 92.60% | 7.10% | 0.34% | 0.00% | NA |
| Indica II | 465 | 71.00% | 28.80% | 0.22% | 0.00% | NA |
| Indica III | 913 | 33.20% | 66.60% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 62.00% | 37.50% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 27.90% | 71.40% | 0.65% | 0.00% | NA |
| Tropical Japonica | 504 | 11.50% | 88.50% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 17.00% | 82.60% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 1.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 43.30% | 54.40% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0619755654 | T -> C | LOC_Os06g33940-LOC_Os06g33950 | intergenic_region ; MODIFIER | silent_mutation | Average:37.339; most accessible tissue: Zhenshan97 flower, score: 62.865 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0619755654 | NA | 4.15E-06 | mr1071 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619755654 | NA | 4.52E-06 | mr1140 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619755654 | NA | 1.05E-06 | mr1203 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619755654 | NA | 1.81E-09 | mr1062_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619755654 | NA | 1.19E-06 | mr1167_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619755654 | NA | 3.64E-06 | mr1333_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619755654 | NA | 9.28E-08 | mr1456_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619755654 | NA | 1.31E-06 | mr1530_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619755654 | NA | 1.14E-07 | mr1582_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619755654 | NA | 1.89E-08 | mr1623_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619755654 | 5.49E-06 | 1.27E-08 | mr1623_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619755654 | NA | 4.43E-06 | mr1667_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619755654 | NA | 8.04E-06 | mr1726_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619755654 | NA | 8.46E-07 | mr1734_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619755654 | NA | 4.92E-06 | mr1879_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |