Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0619749410:

Variant ID: vg0619749410 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 19749410
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 115. )

Flanking Sequence (100 bp) in Reference Genome:

GGGGGGGGGGGAGGGTTTATGAGAGGACATGGAATGAAATGAAGATGATCGTGAAAAAAAAATGAAAGCGTGGATACAAAAAATAGATATGTCTTATAAC[C/T]
GGATTATTGTACATACTGAGTCTCTTAGGCCGGTATATGTAGGGTAGAAAGAGATATAATTATATGCTAACATTACTGTGTTTATCATATATTCTAAATC

Reverse complement sequence

GATTTAGAATATATGATAAACACAGTAATGTTAGCATATAATTATATCTCTTTCTACCCTACATATACCGGCCTAAGAGACTCAGTATGTACAATAATCC[G/A]
GTTATAAGACATATCTATTTTTTGTATCCACGCTTTCATTTTTTTTTCACGATCATCTTCATTTCATTCCATGTCCTCTCATAAACCCTCCCCCCCCCCC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.80%	35.10%	0.13%	0.00%	NA
All Indica	2759	58.80%	41.10%	0.11%	0.00%	NA
All Japonica	1512	83.90%	15.90%	0.13%	0.00%	NA
Aus	269	2.60%	97.40%	0.00%	0.00%	NA
Indica I	595	92.30%	7.70%	0.00%	0.00%	NA
Indica II	465	71.60%	28.40%	0.00%	0.00%	NA
Indica III	913	32.30%	67.60%	0.11%	0.00%	NA
Indica Intermediate	786	56.70%	43.00%	0.25%	0.00%	NA
Temperate Japonica	767	75.90%	23.90%	0.26%	0.00%	NA
Tropical Japonica	504	95.20%	4.80%	0.00%	0.00%	NA
Japonica Intermediate	241	85.90%	14.10%	0.00%	0.00%	NA
VI/Aromatic	96	95.80%	4.20%	0.00%	0.00%	NA
Intermediate	90	78.90%	20.00%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0619749410	C -> T	LOC_Os06g33940.1	upstream_gene_variant ; 2953.0bp to feature; MODIFIER	silent_mutation	Average:38.543; most accessible tissue: Minghui63 root, score: 59.105	N	N	N	N
vg0619749410	C -> T	LOC_Os06g33940.2	upstream_gene_variant ; 2953.0bp to feature; MODIFIER	silent_mutation	Average:38.543; most accessible tissue: Minghui63 root, score: 59.105	N	N	N	N
vg0619749410	C -> T	LOC_Os06g33940-LOC_Os06g33950	intergenic_region ; MODIFIER	silent_mutation	Average:38.543; most accessible tissue: Minghui63 root, score: 59.105	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0619749410	NA	6.90E-06	mr1071	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619749410	NA	3.37E-06	mr1126	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619749410	NA	9.22E-06	mr1203	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619749410	NA	5.38E-06	mr1006_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619749410	NA	5.24E-07	mr1062_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619749410	9.45E-06	9.45E-06	mr1127_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619749410	NA	2.17E-08	mr1167_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619749410	NA	1.49E-06	mr1360_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619749410	NA	1.15E-07	mr1456_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619749410	NA	5.38E-06	mr1530_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619749410	NA	1.94E-09	mr1582_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619749410	NA	1.95E-07	mr1726_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251