Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0619733305:

Variant ID: vg0619733305 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 19733305
Reference Allele: CAlternative Allele: G
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTGACATCAGTAGATTTCTCATGAAAAGTGCTTTCATGCACTATATTTATGATTTTTCCATGACATAATTTGAAAAAACAAAAAAGTAGTAGTCAAATTT[C/G]
TGCATTGATTATCATATTACCGTGATGCTGTCTCAATGGCAAGAAAAGCAATGGAGAGACTATGGTAGTACTCCCTCCGGTTCCATAATTCTTGACGTTT

Reverse complement sequence

AAACGTCAAGAATTATGGAACCGGAGGGAGTACTACCATAGTCTCTCCATTGCTTTTCTTGCCATTGAGACAGCATCACGGTAATATGATAATCAATGCA[G/C]
AAATTTGACTACTACTTTTTTGTTTTTTCAAATTATGTCATGGAAAAATCATAAATATAGTGCATGAAAGCACTTTTCATGAGAAATCTACTGATGTCAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.90% 29.00% 0.04% 0.00% NA
All Indica  2759 98.00% 1.90% 0.04% 0.00% NA
All Japonica  1512 21.30% 78.60% 0.07% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 99.50% 0.30% 0.17% 0.00% NA
Indica II  465 96.60% 3.40% 0.00% 0.00% NA
Indica III  913 99.10% 0.90% 0.00% 0.00% NA
Indica Intermediate  786 96.60% 3.40% 0.00% 0.00% NA
Temperate Japonica  767 29.20% 70.70% 0.13% 0.00% NA
Tropical Japonica  504 11.50% 88.50% 0.00% 0.00% NA
Japonica Intermediate  241 16.60% 83.40% 0.00% 0.00% NA
VI/Aromatic  96 8.30% 91.70% 0.00% 0.00% NA
Intermediate  90 54.40% 45.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0619733305 C -> G LOC_Os06g33930.1 upstream_gene_variant ; 3198.0bp to feature; MODIFIER silent_mutation Average:35.579; most accessible tissue: Callus, score: 72.681 N N N N
vg0619733305 C -> G LOC_Os06g33910-LOC_Os06g33930 intergenic_region ; MODIFIER silent_mutation Average:35.579; most accessible tissue: Callus, score: 72.681 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0619733305 3.43E-07 NA mr1071 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619733305 NA 1.73E-07 mr1071 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619733305 4.78E-07 NA mr1080 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619733305 NA 1.10E-06 mr1080 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619733305 2.74E-06 NA mr1100 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619733305 5.80E-08 NA mr1140 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619733305 NA 3.58E-07 mr1140 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619733305 5.91E-10 NA mr1203 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619733305 NA 6.43E-08 mr1203 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619733305 NA 3.80E-18 mr1242 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619733305 4.19E-07 NA mr1395 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619733305 NA 6.65E-06 mr1395 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619733305 2.97E-08 NA mr1618 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619733305 NA 1.04E-06 mr1618 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619733305 NA 3.11E-15 mr1900 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619733305 NA 1.77E-06 mr1900 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619733305 NA 1.20E-18 mr1062_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619733305 NA 1.80E-07 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619733305 NA 1.18E-16 mr1118_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619733305 NA 3.83E-06 mr1167_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619733305 NA 6.21E-19 mr1239_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619733305 NA 3.16E-23 mr1242_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619733305 NA 1.98E-06 mr1456_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619733305 NA 8.78E-22 mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619733305 NA 9.08E-15 mr1936_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251