Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0619720091:

Variant ID: vg0619720091 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 19720091
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.64, C: 0.36, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:

AAGATAGGAGGACGAGAGTCGTCGGTCGCCTTTATGCGAGGGATTTCTTCTTCGTCATCACCTGATGGTCCTGATGTGTTTCCAAGACATTAGACGGATA[C/A]
ACTGAGGTTATTTAAATCGCCATTGTTTGAGAAGACAACTAACCTGAAGATGTACCTAGCTGAGCGTGAGGTGATCTTTGTTCTTTACCTGAAGACCCAG

Reverse complement sequence

CTGGGTCTTCAGGTAAAGAACAAAGATCACCTCACGCTCAGCTAGGTACATCTTCAGGTTAGTTGTCTTCTCAAACAATGGCGATTTAAATAACCTCAGT[G/T]
TATCCGTCTAATGTCTTGGAAACACATCAGGACCATCAGGTGATGACGAAGAAGAAATCCCTCGCATAAAGGCGACCGACGACTCTCGTCCTCCTATCTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.70%	0.10%	1.27%	30.00%	NA
All Indica	2759	57.00%	0.10%	1.78%	41.17%	NA
All Japonica	1512	91.70%	0.00%	0.40%	7.94%	NA
Aus	269	45.00%	0.00%	1.12%	53.90%	NA
Indica I	595	44.70%	0.00%	1.18%	54.12%	NA
Indica II	465	71.00%	0.20%	2.15%	26.67%	NA
Indica III	913	57.10%	0.00%	1.86%	41.07%	NA
Indica Intermediate	786	57.90%	0.10%	1.91%	40.08%	NA
Temperate Japonica	767	86.20%	0.00%	0.39%	13.43%	NA
Tropical Japonica	504	98.60%	0.00%	0.40%	0.99%	NA
Japonica Intermediate	241	94.60%	0.00%	0.41%	4.98%	NA
VI/Aromatic	96	94.80%	0.00%	0.00%	5.21%	NA
Intermediate	90	83.30%	1.10%	2.22%	13.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0619720091	C -> A	LOC_Os06g33890.1	downstream_gene_variant ; 1499.0bp to feature; MODIFIER	silent_mutation	Average:11.418; most accessible tissue: Minghui63 root, score: 15.664	N	N	N	N
vg0619720091	C -> A	LOC_Os06g33910.1	downstream_gene_variant ; 4251.0bp to feature; MODIFIER	silent_mutation	Average:11.418; most accessible tissue: Minghui63 root, score: 15.664	N	N	N	N
vg0619720091	C -> A	LOC_Os06g33900.1	intron_variant ; MODIFIER	silent_mutation	Average:11.418; most accessible tissue: Minghui63 root, score: 15.664	N	N	N	N
vg0619720091	C -> DEL	N	N	silent_mutation	Average:11.418; most accessible tissue: Minghui63 root, score: 15.664	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0619720091	NA	3.15E-06	mr1441	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619720091	NA	1.91E-12	mr1593	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619720091	NA	2.15E-17	mr1593	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619720091	8.57E-06	9.22E-09	mr1531_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619720091	NA	6.20E-14	mr1593_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619720091	NA	8.84E-19	mr1593_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251