\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0619719272:

Variant ID: vg0619719272 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 19719272
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTTCCGGAGCAACACTCAGCTTGTCAAATATTTCGGTTGCGTCGAGTGCACTCGGACCACCATTATTGAGGAACATGGCTTGGATAATTGGTGCAGCGGC[G/A]
TTGGCGACGTTATCCCTTGCTCCTTCAAGCCTCTTGATCTTACCAACCAGGACGTCAAACTGAGCTTGAGATTTGATCTTGCGATCTGCAAAACACATTC

Reverse complement sequence

GAATGTGTTTTGCAGATCGCAAGATCAAATCTCAAGCTCAGTTTGACGTCCTGGTTGGTAAGATCAAGAGGCTTGAAGGAGCAAGGGATAACGTCGCCAA[C/T]
GCCGCTGCACCAATTATCCAAGCCATGTTCCTCAATAATGGTGGTCCGAGTGCACTCGACGCAACCGAAATATTTGACAAGCTGAGTGTTGCTCCGGAAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 28.60% 1.10% 19.04% 51.33% NA
All Indica  2759 3.60% 1.70% 22.58% 72.09% NA
All Japonica  1512 79.80% 0.10% 3.70% 16.34% NA
Aus  269 0.70% 0.40% 44.98% 53.90% NA
Indica I  595 2.90% 0.70% 8.24% 88.24% NA
Indica II  465 4.70% 0.40% 17.63% 77.20% NA
Indica III  913 2.30% 3.50% 35.16% 59.04% NA
Indica Intermediate  786 5.10% 1.10% 21.76% 72.01% NA
Temperate Japonica  767 72.80% 0.30% 1.96% 25.03% NA
Tropical Japonica  504 89.10% 0.00% 6.55% 4.37% NA
Japonica Intermediate  241 83.00% 0.00% 3.32% 13.69% NA
VI/Aromatic  96 2.10% 0.00% 88.54% 9.38% NA
Intermediate  90 43.30% 0.00% 16.67% 40.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0619719272 G -> A LOC_Os06g33900.1 synonymous_variant ; p.Asn691Asn; LOW synonymous_codon Average:5.919; most accessible tissue: Callus, score: 13.951 N N N N
vg0619719272 G -> DEL LOC_Os06g33900.1 N frameshift_variant Average:5.919; most accessible tissue: Callus, score: 13.951 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0619719272 3.75E-09 NA mr1071 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619719272 NA 1.82E-06 mr1071 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619719272 5.00E-07 NA mr1080 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619719272 2.08E-09 NA mr1140 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619719272 NA 1.91E-06 mr1140 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619719272 2.45E-11 1.03E-95 mr1203 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619719272 NA 4.31E-07 mr1203 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619719272 NA 2.98E-27 mr1238 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619719272 NA 8.34E-27 mr1309 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619719272 4.15E-10 NA mr1395 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619719272 9.23E-06 8.80E-07 mr1395 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619719272 NA 5.41E-18 mr1566 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619719272 6.08E-08 NA mr1618 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619719272 NA 2.36E-08 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619719272 NA 1.07E-13 mr1900 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619719272 NA 1.20E-09 mr1905 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619719272 NA 1.24E-19 mr1167_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619719272 NA 3.95E-07 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619719272 NA 8.96E-07 mr1479_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619719272 NA 2.37E-10 mr1506_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619719272 NA 3.65E-11 mr1714_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619719272 NA 9.18E-16 mr1726_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619719272 NA 6.99E-10 mr1806_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619719272 NA 3.03E-15 mr1950_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619719272 NA 4.43E-06 mr1992_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251