| Variant ID: vg0619717218 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 19717218 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.63, C: 0.37, others allele: 0.00, population size: 70. )
ACAACATGATGGCATATCGACAAGAGGTACGCAAACTGGAGGATAAGTTCGATGGACTTGAGCTCAGTCATGTTCTTCGACACAACAATGAAGCCGCCGA[T/C]
AGACTTGCGAACTTCGGATCCAAGCGCGAGGCAGCGCCCTCTGATGTTTTTGTCGAACACCTTTATACGCCGACGGTACCTCACAAAGATGCCACTCAAG
CTTGAGTGGCATCTTTGTGAGGTACCGTCGGCGTATAAAGGTGTTCGACAAAAACATCAGAGGGCGCTGCCTCGCGCTTGGATCCGAAGTTCGCAAGTCT[A/G]
TCGGCGGCTTCATTGTTGTGTCGAAGAACATGACTGAGCTCAAGTCCATCGAACTTATCCTCCAGTTTGCGTACCTCTTGTCGATATGCCATCATGTTGT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 28.20% | 3.50% | 10.83% | 57.43% | NA |
| All Indica | 2759 | 3.50% | 5.80% | 16.67% | 74.08% | NA |
| All Japonica | 1512 | 79.20% | 0.00% | 1.85% | 18.92% | NA |
| Aus | 269 | 0.70% | 1.50% | 3.35% | 94.42% | NA |
| Indica I | 595 | 1.80% | 3.40% | 8.24% | 86.55% | NA |
| Indica II | 465 | 4.70% | 7.30% | 10.54% | 77.42% | NA |
| Indica III | 913 | 2.60% | 8.00% | 24.42% | 64.95% | NA |
| Indica Intermediate | 786 | 5.00% | 4.10% | 17.68% | 73.28% | NA |
| Temperate Japonica | 767 | 72.00% | 0.00% | 0.39% | 27.64% | NA |
| Tropical Japonica | 504 | 88.70% | 0.00% | 4.76% | 6.55% | NA |
| Japonica Intermediate | 241 | 82.60% | 0.00% | 0.41% | 17.01% | NA |
| VI/Aromatic | 96 | 0.00% | 0.00% | 1.04% | 98.96% | NA |
| Intermediate | 90 | 43.30% | 2.20% | 15.56% | 38.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0619717218 | T -> C | LOC_Os06g33890.1 | synonymous_variant ; p.Asp1559Asp; LOW | synonymous_codon | Average:9.101; most accessible tissue: Minghui63 panicle, score: 16.27 | N | N | N | N |
| vg0619717218 | T -> DEL | LOC_Os06g33890.1 | N | frameshift_variant | Average:9.101; most accessible tissue: Minghui63 panicle, score: 16.27 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0619717218 | 2.97E-09 | 2.18E-73 | mr1033 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619717218 | NA | 5.40E-08 | mr1033 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619717218 | NA | 3.54E-06 | mr1071 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619717218 | 4.53E-06 | 1.54E-06 | mr1080 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619717218 | NA | 4.69E-07 | mr1082 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619717218 | NA | 4.08E-06 | mr1103 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619717218 | 5.64E-07 | NA | mr1140 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619717218 | NA | 2.08E-06 | mr1140 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619717218 | 5.40E-08 | NA | mr1203 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619717218 | 3.91E-07 | 8.83E-08 | mr1203 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/