\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0619717218:

Variant ID: vg0619717218 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 19717218
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.63, C: 0.37, others allele: 0.00, population size: 70. )

Flanking Sequence (100 bp) in Reference Genome:


ACAACATGATGGCATATCGACAAGAGGTACGCAAACTGGAGGATAAGTTCGATGGACTTGAGCTCAGTCATGTTCTTCGACACAACAATGAAGCCGCCGA[T/C]
AGACTTGCGAACTTCGGATCCAAGCGCGAGGCAGCGCCCTCTGATGTTTTTGTCGAACACCTTTATACGCCGACGGTACCTCACAAAGATGCCACTCAAG

Reverse complement sequence

CTTGAGTGGCATCTTTGTGAGGTACCGTCGGCGTATAAAGGTGTTCGACAAAAACATCAGAGGGCGCTGCCTCGCGCTTGGATCCGAAGTTCGCAAGTCT[A/G]
TCGGCGGCTTCATTGTTGTGTCGAAGAACATGACTGAGCTCAAGTCCATCGAACTTATCCTCCAGTTTGCGTACCTCTTGTCGATATGCCATCATGTTGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 28.20% 3.50% 10.83% 57.43% NA
All Indica  2759 3.50% 5.80% 16.67% 74.08% NA
All Japonica  1512 79.20% 0.00% 1.85% 18.92% NA
Aus  269 0.70% 1.50% 3.35% 94.42% NA
Indica I  595 1.80% 3.40% 8.24% 86.55% NA
Indica II  465 4.70% 7.30% 10.54% 77.42% NA
Indica III  913 2.60% 8.00% 24.42% 64.95% NA
Indica Intermediate  786 5.00% 4.10% 17.68% 73.28% NA
Temperate Japonica  767 72.00% 0.00% 0.39% 27.64% NA
Tropical Japonica  504 88.70% 0.00% 4.76% 6.55% NA
Japonica Intermediate  241 82.60% 0.00% 0.41% 17.01% NA
VI/Aromatic  96 0.00% 0.00% 1.04% 98.96% NA
Intermediate  90 43.30% 2.20% 15.56% 38.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0619717218 T -> C LOC_Os06g33890.1 synonymous_variant ; p.Asp1559Asp; LOW synonymous_codon Average:9.101; most accessible tissue: Minghui63 panicle, score: 16.27 N N N N
vg0619717218 T -> DEL LOC_Os06g33890.1 N frameshift_variant Average:9.101; most accessible tissue: Minghui63 panicle, score: 16.27 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0619717218 2.97E-09 2.18E-73 mr1033 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619717218 NA 5.40E-08 mr1033 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619717218 NA 3.54E-06 mr1071 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619717218 4.53E-06 1.54E-06 mr1080 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619717218 NA 4.69E-07 mr1082 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619717218 NA 4.08E-06 mr1103 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619717218 5.64E-07 NA mr1140 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619717218 NA 2.08E-06 mr1140 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619717218 5.40E-08 NA mr1203 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619717218 3.91E-07 8.83E-08 mr1203 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619717218 NA 1.18E-07 mr1226 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619717218 2.46E-06 NA mr1395 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619717218 NA 2.39E-06 mr1395 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619717218 1.16E-06 NA mr1618 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619717218 3.39E-06 1.28E-06 mr1618 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619717218 2.29E-08 NA mr1033_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251