\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0619711521:

Variant ID: vg0619711521 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 19711521
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.87, A: 0.13, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


GAGCTGTGTGACGACCCATGTGCAGCCATGAGCTCTCGATCGTGAGTCACTACCTTAGCTAGGTAAAGACCCGATAGATCGGCTTTTTGCATCATCCTCC[A/G]
AGCTTTATTAGCTAGCTAATAAGCTCATAATCATGATGGGGTCGTGCATAGATTTTGTGAGATCACGTGGTCCGGCCGGCGCGACCGAGCGAACTAGTCC

Reverse complement sequence

GGACTAGTTCGCTCGGTCGCGCCGGCCGGACCACGTGATCTCACAAAATCTATGCACGACCCCATCATGATTATGAGCTTATTAGCTAGCTAATAAAGCT[T/C]
GGAGGATGATGCAAAAAGCCGATCTATCGGGTCTTTACCTAGCTAAGGTAGTGACTCACGATCGAGAGCTCATGGCTGCACATGGGTCGTCACACAGCTC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.00% 4.10% 1.82% 0.00% NA
All Indica  2759 95.10% 2.80% 2.10% 0.00% NA
All Japonica  1512 97.60% 0.80% 1.59% 0.00% NA
Aus  269 98.50% 1.50% 0.00% 0.00% NA
Indica I  595 93.90% 2.00% 4.03% 0.00% NA
Indica II  465 95.50% 3.70% 0.86% 0.00% NA
Indica III  913 96.30% 3.30% 0.44% 0.00% NA
Indica Intermediate  786 94.30% 2.40% 3.31% 0.00% NA
Temperate Japonica  767 99.50% 0.40% 0.13% 0.00% NA
Tropical Japonica  504 95.20% 0.40% 4.37% 0.00% NA
Japonica Intermediate  241 96.70% 2.90% 0.41% 0.00% NA
VI/Aromatic  96 6.20% 92.70% 1.04% 0.00% NA
Intermediate  90 82.20% 14.40% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0619711521 A -> G LOC_Os06g33890.1 upstream_gene_variant ; 976.0bp to feature; MODIFIER silent_mutation Average:76.377; most accessible tissue: Callus, score: 95.75 N N N N
vg0619711521 A -> G LOC_Os06g33880-LOC_Os06g33890 intergenic_region ; MODIFIER silent_mutation Average:76.377; most accessible tissue: Callus, score: 95.75 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0619711521 A G -0.04 0.01 0.02 0.03 0.01 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0619711521 2.16E-06 3.86E-10 mr1033 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619711521 NA 1.30E-07 mr1082 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619711521 NA 1.23E-06 mr1176 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619711521 1.34E-07 NA mr1203 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619711521 NA 7.52E-07 mr1203 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619711521 NA 4.10E-07 mr1226 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619711521 NA 6.22E-26 mr1238 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619711521 NA 6.57E-08 mr1301 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619711521 NA 2.77E-07 mr1410 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619711521 NA 4.99E-15 mr1900 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619711521 NA 1.02E-14 mr1033_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619711521 NA 8.71E-06 mr1402_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619711521 NA 1.01E-07 mr1765_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619711521 NA 1.49E-20 mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251