\
| Variant ID: vg0619710671 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 19710671 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
CTATAAATACACACACATACATGCATACCTATCCCTATAAATACACAACATACACCCCTACCCCTATGAAAATCTTCGAGAGATTGGACCGGCACATCTT[G/A]
ATATATTTTGAGATTAATTAAGTCACCATAAATATCTCTGTCAACGAGTAAACCTACCACTGATAAAATAATTAGCCGTAAAATACGAGATCACCCATGT
ACATGGGTGATCTCGTATTTTACGGCTAATTATTTTATCAGTGGTAGGTTTACTCGTTGACAGAGATATTTATGGTGACTTAATTAATCTCAAAATATAT[C/T]
AAGATGTGCCGGTCCAATCTCTCGAAGATTTTCATAGGGGTAGGGGTGTATGTTGTGTATTTATAGGGATAGGTATGCATGTATGTGTGTGTATTTATAG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.70% | 35.10% | 0.15% | 0.00% | NA |
| All Indica | 2759 | 96.50% | 3.30% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 5.60% | 94.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.50% | 2.20% | 0.34% | 0.00% | NA |
| Indica II | 465 | 95.90% | 4.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.80% | 1.10% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 93.40% | 6.40% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 3.40% | 96.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 10.70% | 89.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 1.70% | 98.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 6.20% | 93.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 44.40% | 53.30% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0619710671 | G -> A | LOC_Os06g33890.1 | upstream_gene_variant ; 1826.0bp to feature; MODIFIER | silent_mutation | Average:52.655; most accessible tissue: Minghui63 young leaf, score: 64.378 | N | N | N | N |
| vg0619710671 | G -> A | LOC_Os06g33880-LOC_Os06g33890 | intergenic_region ; MODIFIER | silent_mutation | Average:52.655; most accessible tissue: Minghui63 young leaf, score: 64.378 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0619710671 | 2.00E-13 | 1.58E-83 | mr1033 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619710671 | NA | 1.65E-26 | mr1072 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619710671 | NA | 6.51E-50 | mr1154 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619710671 | 1.18E-10 | 2.64E-48 | mr1176 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619710671 | NA | 2.11E-06 | mr1278 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619710671 | NA | 2.30E-29 | mr1333 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619710671 | 9.05E-06 | 8.22E-73 | mr1536 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619710671 | NA | 1.86E-26 | mr1686 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619710671 | NA | 2.15E-07 | mr1824 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619710671 | NA | 1.95E-69 | mr1865 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619710671 | 2.93E-16 | 1.39E-114 | mr1033_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619710671 | NA | 6.92E-96 | mr1536_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |