Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0619710623:

Variant ID: vg0619710623 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 19710623
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAAATAGTACAAACATATTTATTAACATATATGTGTGGATACTTATCCCTATAAATACACACACATACATGCATACCTATCCCTATAAATACACAACATA[C/T]
ACCCCTACCCCTATGAAAATCTTCGAGAGATTGGACCGGCACATCTTGATATATTTTGAGATTAATTAAGTCACCATAAATATCTCTGTCAACGAGTAAA

Reverse complement sequence

TTTACTCGTTGACAGAGATATTTATGGTGACTTAATTAATCTCAAAATATATCAAGATGTGCCGGTCCAATCTCTCGAAGATTTTCATAGGGGTAGGGGT[G/A]
TATGTTGTGTATTTATAGGGATAGGTATGCATGTATGTGTGTGTATTTATAGGGATAAGTATCCACACATATATGTTAATAAATATGTTTGTACTATTTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	70.60%	29.20%	0.19%	0.00%	NA
All Indica	2759	97.80%	2.10%	0.14%	0.00%	NA
All Japonica	1512	21.00%	78.90%	0.07%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.50%	0.50%	0.00%	0.00%	NA
Indica II	465	96.60%	3.40%	0.00%	0.00%	NA
Indica III	913	99.00%	0.90%	0.11%	0.00%	NA
Indica Intermediate	786	95.80%	3.80%	0.38%	0.00%	NA
Temperate Japonica	767	28.90%	71.10%	0.00%	0.00%	NA
Tropical Japonica	504	11.30%	88.70%	0.00%	0.00%	NA
Japonica Intermediate	241	16.20%	83.40%	0.41%	0.00%	NA
VI/Aromatic	96	9.40%	90.60%	0.00%	0.00%	NA
Intermediate	90	48.90%	46.70%	4.44%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0619710623	C -> T	LOC_Os06g33890.1	upstream_gene_variant ; 1874.0bp to feature; MODIFIER	silent_mutation	Average:54.632; most accessible tissue: Minghui63 young leaf, score: 67.374	N	N	N	N
vg0619710623	C -> T	LOC_Os06g33880-LOC_Os06g33890	intergenic_region ; MODIFIER	silent_mutation	Average:54.632; most accessible tissue: Minghui63 young leaf, score: 67.374	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0619710623	NA	5.83E-07	mr1071	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619710623	NA	7.02E-06	mr1080	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619710623	2.70E-06	NA	mr1100	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619710623	5.89E-07	NA	mr1140	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619710623	NA	1.02E-06	mr1140	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619710623	6.36E-09	NA	mr1203	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619710623	NA	1.36E-07	mr1203	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619710623	3.62E-06	NA	mr1395	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619710623	3.89E-07	NA	mr1618	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619710623	NA	2.59E-06	mr1618	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619710623	NA	9.12E-14	mr1900	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619710623	NA	6.62E-06	mr1900	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619710623	NA	3.00E-18	mr1062_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619710623	NA	9.59E-08	mr1062_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619710623	NA	7.79E-16	mr1118_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619710623	NA	2.17E-06	mr1167_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619710623	NA	1.97E-19	mr1239_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619710623	NA	4.22E-23	mr1242_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619710623	NA	1.89E-07	mr1456_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619710623	NA	6.15E-10	mr1506_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619710623	NA	7.19E-15	mr1936_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251