Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0619685778:

Variant ID: vg0619685778 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 19685778
Reference Allele: A	Alternative Allele: C
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAGAAACAAAATATAATAAGCACTGATCTGAGGTTTAAAGCATACATCGGCTGCAGGTCCGATGTCATGAAATCCACAAGATTAGATTAAACAGTGAAAC[A/C]
TTTGTTGTCATCGGCTAAATCCAACTTATATGTATGTGCAATCCTTATGAGCCAATGCAATGTCTAGATAACTCAAAAGCTGAAACCCCGATGAAACCCT

Reverse complement sequence

AGGGTTTCATCGGGGTTTCAGCTTTTGAGTTATCTAGACATTGCATTGGCTCATAAGGATTGCACATACATATAAGTTGGATTTAGCCGATGACAACAAA[T/G]
GTTTCACTGTTTAATCTAATCTTGTGGATTTCATGACATCGGACCTGCAGCCGATGTATGCTTTAAACCTCAGATCAGTGCTTATTATATTTTGTTTCTA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	29.60%	8.30%	18.41%	43.74%	NA
All Indica	2759	5.10%	5.50%	21.93%	67.45%	NA
All Japonica	1512	80.00%	14.60%	3.04%	2.45%	NA
Aus	269	1.10%	6.70%	72.49%	19.70%	NA
Indica I	595	3.20%	4.50%	19.16%	73.11%	NA
Indica II	465	4.70%	4.50%	22.15%	68.60%	NA
Indica III	913	4.30%	6.60%	21.80%	67.36%	NA
Indica Intermediate	786	7.90%	5.50%	24.05%	62.60%	NA
Temperate Japonica	767	73.30%	23.60%	0.91%	2.22%	NA
Tropical Japonica	504	88.50%	1.60%	7.14%	2.78%	NA
Japonica Intermediate	241	83.40%	12.90%	1.24%	2.49%	NA
VI/Aromatic	96	3.10%	1.00%	6.25%	89.58%	NA
Intermediate	90	44.40%	2.20%	20.00%	33.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0619685778	A -> C	LOC_Os06g33840.1	upstream_gene_variant ; 985.0bp to feature; MODIFIER	silent_mutation	Average:24.336; most accessible tissue: Zhenshan97 flag leaf, score: 39.979	N	N	N	N
vg0619685778	A -> C	LOC_Os06g33820.1	downstream_gene_variant ; 3942.0bp to feature; MODIFIER	silent_mutation	Average:24.336; most accessible tissue: Zhenshan97 flag leaf, score: 39.979	N	N	N	N
vg0619685778	A -> C	LOC_Os06g33830.1	downstream_gene_variant ; 503.0bp to feature; MODIFIER	silent_mutation	Average:24.336; most accessible tissue: Zhenshan97 flag leaf, score: 39.979	N	N	N	N
vg0619685778	A -> C	LOC_Os06g33850.1	downstream_gene_variant ; 4324.0bp to feature; MODIFIER	silent_mutation	Average:24.336; most accessible tissue: Zhenshan97 flag leaf, score: 39.979	N	N	N	N
vg0619685778	A -> C	LOC_Os06g33830-LOC_Os06g33840	intergenic_region ; MODIFIER	silent_mutation	Average:24.336; most accessible tissue: Zhenshan97 flag leaf, score: 39.979	N	N	N	N
vg0619685778	A -> DEL	N	N	silent_mutation	Average:24.336; most accessible tissue: Zhenshan97 flag leaf, score: 39.979	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0619685778	NA	6.89E-08	mr1071	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619685778	NA	1.19E-06	mr1080	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619685778	NA	1.51E-07	mr1140	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619685778	4.38E-07	NA	mr1203	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619685778	2.31E-06	6.60E-09	mr1203	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619685778	NA	4.04E-06	mr1395	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619685778	NA	7.69E-06	mr1613	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619685778	NA	1.13E-07	mr1618	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619685778	NA	4.74E-20	mr1676	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619685778	NA	1.63E-06	mr1900	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619685778	NA	9.10E-07	mr1020_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619685778	NA	6.22E-08	mr1062_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619685778	NA	6.74E-19	mr1167_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619685778	NA	1.56E-06	mr1167_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619685778	NA	3.43E-06	mr1173_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619685778	NA	1.74E-06	mr1418_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619685778	NA	7.56E-06	mr1452_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619685778	NA	5.22E-07	mr1456_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619685778	NA	8.23E-06	mr1470_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619685778	NA	2.39E-07	mr1479_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619685778	NA	1.93E-06	mr1488_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619685778	NA	2.57E-09	mr1506_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619685778	NA	8.29E-06	mr1574_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619685778	NA	3.10E-16	mr1726_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619685778	NA	8.19E-11	mr1765_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619685778	NA	3.22E-06	mr1786_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619685778	NA	1.17E-07	mr1821_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251