| Variant ID: vg0619685778 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 19685778 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TAGAAACAAAATATAATAAGCACTGATCTGAGGTTTAAAGCATACATCGGCTGCAGGTCCGATGTCATGAAATCCACAAGATTAGATTAAACAGTGAAAC[A/C]
TTTGTTGTCATCGGCTAAATCCAACTTATATGTATGTGCAATCCTTATGAGCCAATGCAATGTCTAGATAACTCAAAAGCTGAAACCCCGATGAAACCCT
AGGGTTTCATCGGGGTTTCAGCTTTTGAGTTATCTAGACATTGCATTGGCTCATAAGGATTGCACATACATATAAGTTGGATTTAGCCGATGACAACAAA[T/G]
GTTTCACTGTTTAATCTAATCTTGTGGATTTCATGACATCGGACCTGCAGCCGATGTATGCTTTAAACCTCAGATCAGTGCTTATTATATTTTGTTTCTA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 29.60% | 8.30% | 18.41% | 43.74% | NA |
| All Indica | 2759 | 5.10% | 5.50% | 21.93% | 67.45% | NA |
| All Japonica | 1512 | 80.00% | 14.60% | 3.04% | 2.45% | NA |
| Aus | 269 | 1.10% | 6.70% | 72.49% | 19.70% | NA |
| Indica I | 595 | 3.20% | 4.50% | 19.16% | 73.11% | NA |
| Indica II | 465 | 4.70% | 4.50% | 22.15% | 68.60% | NA |
| Indica III | 913 | 4.30% | 6.60% | 21.80% | 67.36% | NA |
| Indica Intermediate | 786 | 7.90% | 5.50% | 24.05% | 62.60% | NA |
| Temperate Japonica | 767 | 73.30% | 23.60% | 0.91% | 2.22% | NA |
| Tropical Japonica | 504 | 88.50% | 1.60% | 7.14% | 2.78% | NA |
| Japonica Intermediate | 241 | 83.40% | 12.90% | 1.24% | 2.49% | NA |
| VI/Aromatic | 96 | 3.10% | 1.00% | 6.25% | 89.58% | NA |
| Intermediate | 90 | 44.40% | 2.20% | 20.00% | 33.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0619685778 | A -> C | LOC_Os06g33840.1 | upstream_gene_variant ; 985.0bp to feature; MODIFIER | silent_mutation | Average:24.336; most accessible tissue: Zhenshan97 flag leaf, score: 39.979 | N | N | N | N |
| vg0619685778 | A -> C | LOC_Os06g33820.1 | downstream_gene_variant ; 3942.0bp to feature; MODIFIER | silent_mutation | Average:24.336; most accessible tissue: Zhenshan97 flag leaf, score: 39.979 | N | N | N | N |
| vg0619685778 | A -> C | LOC_Os06g33830.1 | downstream_gene_variant ; 503.0bp to feature; MODIFIER | silent_mutation | Average:24.336; most accessible tissue: Zhenshan97 flag leaf, score: 39.979 | N | N | N | N |
| vg0619685778 | A -> C | LOC_Os06g33850.1 | downstream_gene_variant ; 4324.0bp to feature; MODIFIER | silent_mutation | Average:24.336; most accessible tissue: Zhenshan97 flag leaf, score: 39.979 | N | N | N | N |
| vg0619685778 | A -> C | LOC_Os06g33830-LOC_Os06g33840 | intergenic_region ; MODIFIER | silent_mutation | Average:24.336; most accessible tissue: Zhenshan97 flag leaf, score: 39.979 | N | N | N | N |
| vg0619685778 | A -> DEL | N | N | silent_mutation | Average:24.336; most accessible tissue: Zhenshan97 flag leaf, score: 39.979 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0619685778 | NA | 6.89E-08 | mr1071 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619685778 | NA | 1.19E-06 | mr1080 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619685778 | NA | 1.51E-07 | mr1140 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619685778 | 4.38E-07 | NA | mr1203 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619685778 | 2.31E-06 | 6.60E-09 | mr1203 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619685778 | NA | 4.04E-06 | mr1395 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619685778 | NA | 7.69E-06 | mr1613 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619685778 | NA | 1.13E-07 | mr1618 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619685778 | NA | 4.74E-20 | mr1676 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619685778 | NA | 1.63E-06 | mr1900 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/