\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0619681988:

Variant ID: vg0619681988 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 19681988
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAAGGAGGGAACAATAGTGAGAAGAAAGTACGTGCGGTCAACCGTCACCGCCGATGTATTGCCGTAATTATTGTGTACACGATGTAAACTATTTTGGATG[A/T]
ATTGATTATCCAAATAAATCAATTGTTGTATGGCATATGTTAATTACGTACGATTATTAGAATTCTTAACAATTTTAAATCATGCATATGCTAGTTATAT

Reverse complement sequence

ATATAACTAGCATATGCATGATTTAAAATTGTTAAGAATTCTAATAATCGTACGTAATTAACATATGCCATACAACAATTGATTTATTTGGATAATCAAT[T/A]
CATCCAAAATAGTTTACATCGTGTACACAATAATTACGGCAATACATCGGCGGTGACGGTTGACCGCACGTACTTTCTTCTCACTATTGTTCCCTCCTTG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.20% 27.40% 4.44% 2.01% NA
All Indica  2759 97.30% 2.00% 0.65% 0.07% NA
All Japonica  1512 8.00% 79.40% 12.37% 0.20% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 97.30% 0.70% 2.02% 0.00% NA
Indica II  465 96.60% 3.40% 0.00% 0.00% NA
Indica III  913 99.10% 0.80% 0.00% 0.11% NA
Indica Intermediate  786 95.50% 3.60% 0.76% 0.13% NA
Temperate Japonica  767 7.20% 72.80% 20.08% 0.00% NA
Tropical Japonica  504 11.70% 87.70% 0.60% 0.00% NA
Japonica Intermediate  241 2.90% 83.40% 12.45% 1.24% NA
VI/Aromatic  96 11.50% 1.00% 2.08% 85.42% NA
Intermediate  90 47.80% 40.00% 3.33% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0619681988 A -> T LOC_Os06g33830.1 upstream_gene_variant ; 2607.0bp to feature; MODIFIER silent_mutation Average:17.269; most accessible tissue: Zhenshan97 root, score: 23.888 N N N N
vg0619681988 A -> T LOC_Os06g33840.1 upstream_gene_variant ; 4775.0bp to feature; MODIFIER silent_mutation Average:17.269; most accessible tissue: Zhenshan97 root, score: 23.888 N N N N
vg0619681988 A -> T LOC_Os06g33820.1 downstream_gene_variant ; 152.0bp to feature; MODIFIER silent_mutation Average:17.269; most accessible tissue: Zhenshan97 root, score: 23.888 N N N N
vg0619681988 A -> T LOC_Os06g33820-LOC_Os06g33830 intergenic_region ; MODIFIER silent_mutation Average:17.269; most accessible tissue: Zhenshan97 root, score: 23.888 N N N N
vg0619681988 A -> DEL N N silent_mutation Average:17.269; most accessible tissue: Zhenshan97 root, score: 23.888 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0619681988 2.08E-07 NA mr1071 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619681988 NA 5.51E-07 mr1071 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619681988 NA 9.81E-06 mr1080 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619681988 1.19E-07 NA mr1140 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619681988 NA 1.38E-06 mr1140 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619681988 8.37E-10 NA mr1203 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619681988 NA 2.29E-07 mr1203 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619681988 NA 2.02E-27 mr1238 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619681988 NA 2.82E-27 mr1309 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619681988 1.59E-06 NA mr1395 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619681988 NA 2.78E-16 mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619681988 1.20E-07 NA mr1618 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619681988 NA 3.54E-06 mr1618 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619681988 NA 2.23E-15 mr1900 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619681988 NA 9.54E-06 mr1900 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619681988 NA 2.76E-06 mr1020_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619681988 NA 5.86E-21 mr1042_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619681988 NA 3.38E-19 mr1062_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619681988 NA 1.01E-07 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619681988 NA 2.38E-21 mr1167_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619681988 NA 1.46E-06 mr1167_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619681988 NA 6.24E-06 mr1346_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619681988 NA 1.69E-07 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619681988 NA 2.27E-07 mr1456_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619681988 NA 1.82E-07 mr1479_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619681988 NA 3.64E-07 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619681988 NA 1.60E-11 mr1506_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619681988 NA 2.62E-06 mr1574_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619681988 NA 6.40E-11 mr1680_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619681988 NA 2.29E-17 mr1726_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619681988 NA 1.59E-09 mr1765_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619681988 NA 5.10E-21 mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619681988 NA 4.15E-15 mr1950_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619681988 NA 6.60E-06 mr1992_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251