\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0619681040:

Variant ID: vg0619681040 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 19681040
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:


AAGTATGTTCATAACCGTGCTCGTCCAGAGGCAAGCATCGCCAAGGGATATGGAATAGAGGAGGTCATCGAATTTTGCGTAGAATTTACTGAAGACCTTC[G/A]
CCCAATCGGGGTACCTGAATCACGCCATGAAGGGAGACTACGGGGAAAGAGAACTCTCGGAAGGAAAGCAATAATGACGGTAGACAACAATTTATTCCGT

Reverse complement sequence

ACGGAATAAATTGTTGTCTACCGTCATTATTGCTTTCCTTCCGAGAGTTCTCTTTCCCCGTAGTCTCCCTTCATGGCGTGATTCAGGTACCCCGATTGGG[C/T]
GAAGGTCTTCAGTAAATTCTACGCAAAATTCGATGACCTCCTCTATTCCATATCCCTTGGCGATGCTTGCCTCTGGACGAGCACGGTTATGAACATACTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.10% 32.80% 0.21% 1.95% NA
All Indica  2759 97.00% 2.80% 0.22% 0.07% NA
All Japonica  1512 5.80% 94.00% 0.00% 0.20% NA
Aus  269 97.40% 2.20% 0.37% 0.00% NA
Indica I  595 97.30% 2.70% 0.00% 0.00% NA
Indica II  465 96.10% 3.70% 0.22% 0.00% NA
Indica III  913 98.60% 1.00% 0.33% 0.11% NA
Indica Intermediate  786 95.30% 4.30% 0.25% 0.13% NA
Temperate Japonica  767 3.40% 96.60% 0.00% 0.00% NA
Tropical Japonica  504 11.50% 88.50% 0.00% 0.00% NA
Japonica Intermediate  241 1.70% 97.10% 0.00% 1.24% NA
VI/Aromatic  96 10.40% 5.20% 1.04% 83.33% NA
Intermediate  90 45.60% 44.40% 2.22% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0619681040 G -> A LOC_Os06g33820.1 missense_variant ; p.Arg716His; MODERATE nonsynonymous_codon ; R716H Average:20.987; most accessible tissue: Zhenshan97 flag leaf, score: 28.494 benign 0.738 TOLERATED 0.05
vg0619681040 G -> DEL LOC_Os06g33820.1 N frameshift_variant Average:20.987; most accessible tissue: Zhenshan97 flag leaf, score: 28.494 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0619681040 1.61E-14 8.89E-84 mr1033 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619681040 NA 1.67E-26 mr1072 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619681040 NA 1.06E-28 mr1075 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619681040 2.58E-08 1.86E-44 mr1176 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619681040 2.54E-07 9.46E-76 mr1536 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619681040 NA 3.52E-52 mr1795 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619681040 NA 5.14E-07 mr1824 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619681040 NA 3.32E-60 mr1962 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619681040 2.22E-14 3.16E-110 mr1033_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619681040 NA 7.40E-15 mr1118_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619681040 NA 8.59E-32 mr1150_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619681040 NA 2.25E-22 mr1242_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619681040 NA 4.00E-19 mr1276_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619681040 2.30E-09 6.42E-103 mr1536_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619681040 NA 5.76E-07 mr1548_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619681040 NA 8.23E-13 mr1904_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251