\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0619679605:

Variant ID: vg0619679605 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 19679605
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAAAGACTTTGGAAAAGACGCACGAAACATACGGTTTGGTTTAAGTATGGATGGCATGAATCCTTTTAGAGAGATGAACAGCGGCCATAGCACTTGGCCC[G/A]
TTACGATGTGTATCTACAACCTCCCCCCTTGGCTATGCATGAAGAGGAAGTACATAATGATGCCGATTATTATTCAAGGCCCCAAGCAACCTGGTAACGA

Reverse complement sequence

TCGTTACCAGGTTGCTTGGGGCCTTGAATAATAATCGGCATCATTATGTACTTCCTCTTCATGCATAGCCAAGGGGGGAGGTTGTAGATACACATCGTAA[C/T]
GGGCCAAGTGCTATGGCCGCTGTTCATCTCTCTAAAAGGATTCATGCCATCCATACTTAAACCAAACCGTATGTTTCGTGCGTCTTTTCCAAAGTCTTTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.00% 5.10% 0.08% 1.80% NA
All Indica  2759 99.30% 0.70% 0.00% 0.07% NA
All Japonica  1512 85.20% 14.60% 0.00% 0.20% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.20% 1.80% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.90% 0.00% 0.00% 0.11% NA
Indica Intermediate  786 99.00% 0.90% 0.00% 0.13% NA
Temperate Japonica  767 75.50% 24.50% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 86.30% 12.40% 0.00% 1.24% NA
VI/Aromatic  96 17.70% 1.00% 3.12% 78.12% NA
Intermediate  90 93.30% 0.00% 1.11% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0619679605 G -> A LOC_Os06g33820.1 missense_variant ; p.Val279Ile; MODERATE nonsynonymous_codon ; V279I Average:16.122; most accessible tissue: Zhenshan97 flower, score: 24.143 benign 0.935 DELETERIOUS 0.04
vg0619679605 G -> DEL LOC_Os06g33820.1 N frameshift_variant Average:16.122; most accessible tissue: Zhenshan97 flower, score: 24.143 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0619679605 1.22E-06 NA mr1071 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619679605 NA 2.21E-07 mr1071 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619679605 2.14E-06 NA mr1140 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619679605 NA 1.08E-06 mr1140 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619679605 3.28E-08 NA mr1203 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619679605 NA 4.85E-08 mr1203 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619679605 NA 7.09E-06 mr1395 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619679605 NA 4.62E-06 mr1613 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619679605 2.89E-06 NA mr1618 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619679605 NA 1.35E-06 mr1618 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619679605 NA 6.75E-06 mr1913 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619679605 5.40E-06 NA mr1037_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619679605 NA 3.03E-07 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619679605 NA 8.91E-06 mr1100_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619679605 NA 3.21E-06 mr1167_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619679605 NA 1.87E-06 mr1456_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619679605 NA 3.52E-07 mr1456_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619679605 NA 1.17E-06 mr1565_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619679605 NA 4.61E-06 mr1726_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251