Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0619651371:

Variant ID: vg0619651371 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 19651371
Reference Allele: T	Alternative Allele: A
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTGCACAGCGTCTTCTGGAGCAAACTGCTCTTCCGCTCCAACATCTACACGATTGCAAACGAAAAACAAATAAACACAAAGAAAAACTAACTAAATAACA[T/A]
CAAATGAAATAACCAATTAAACCAGGAGGTAGAGCTCGATTTTAGAAGAATTTAGGAAGAAGAATGGGTCAAATCGGAGTTCAAACGGAAAAGTTATAGC

Reverse complement sequence

GCTATAACTTTTCCGTTTGAACTCCGATTTGACCCATTCTTCTTCCTAAATTCTTCTAAAATCGAGCTCTACCTCCTGGTTTAATTGGTTATTTCATTTG[A/T]
TGTTATTTAGTTAGTTTTTCTTTGTGTTTATTTGTTTTTCGTTTGCAATCGTGTAGATGTTGGAGCGGAAGAGCAGTTTGCTCCAGAAGACGCTGTGCAA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.90%	34.30%	0.70%	0.06%	NA
All Indica	2759	96.70%	3.10%	0.22%	0.00%	NA
All Japonica	1512	5.80%	93.80%	0.33%	0.00%	NA
Aus	269	97.00%	2.60%	0.37%	0.00%	NA
Indica I	595	96.80%	2.70%	0.50%	0.00%	NA
Indica II	465	95.50%	3.90%	0.65%	0.00%	NA
Indica III	913	98.50%	1.50%	0.00%	0.00%	NA
Indica Intermediate	786	95.20%	4.80%	0.00%	0.00%	NA
Temperate Japonica	767	3.30%	96.60%	0.13%	0.00%	NA
Tropical Japonica	504	11.50%	88.50%	0.00%	0.00%	NA
Japonica Intermediate	241	2.10%	96.30%	1.66%	0.00%	NA
VI/Aromatic	96	9.40%	67.70%	19.79%	3.12%	NA
Intermediate	90	48.90%	48.90%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0619651371	T -> A	LOC_Os06g33790.1	upstream_gene_variant ; 2900.0bp to feature; MODIFIER	silent_mutation	Average:30.942; most accessible tissue: Zhenshan97 panicle, score: 46.362	N	N	N	N
vg0619651371	T -> A	LOC_Os06g33770.1	downstream_gene_variant ; 3283.0bp to feature; MODIFIER	silent_mutation	Average:30.942; most accessible tissue: Zhenshan97 panicle, score: 46.362	N	N	N	N
vg0619651371	T -> A	LOC_Os06g33780.1	intron_variant ; MODIFIER	silent_mutation	Average:30.942; most accessible tissue: Zhenshan97 panicle, score: 46.362	N	N	N	N
vg0619651371	T -> DEL	N	N	silent_mutation	Average:30.942; most accessible tissue: Zhenshan97 panicle, score: 46.362	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0619651371	7.80E-09	4.27E-74	mr1033	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619651371	9.72E-06	3.93E-10	mr1033	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619651371	NA	8.68E-07	mr1082	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619651371	1.97E-06	1.65E-41	mr1176	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619651371	NA	6.16E-07	mr1176	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619651371	NA	1.37E-06	mr1278	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619651371	NA	3.22E-08	mr1301	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619651371	NA	1.97E-07	mr1410	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619651371	4.89E-11	2.03E-103	mr1033_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619651371	3.14E-06	3.50E-16	mr1033_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619651371	NA	1.13E-93	mr1536_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251