\
| Variant ID: vg0619650681 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 19650681 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 227. )
ACACCTTTCCCACACACAGACAAGAAAGTCCCCATGGCGAACCTAAACTCCTATCATCTAGCCACCTGGGCTGACAGTGCCAAGACTCGGAATCCTACTG[G/A]
GCCAGGTTCTTCCCATGAGAACATGTGGTTGCATGTTAGGCTCAAATCCATAACTTATGAAGTGAAGTCCTTAATTGACCAAGGCAACTTGCCAAACTAC
GTAGTTTGGCAAGTTGCCTTGGTCAATTAAGGACTTCACTTCATAAGTTATGGATTTGAGCCTAACATGCAACCACATGTTCTCATGGGAAGAACCTGGC[C/T]
CAGTAGGATTCCGAGTCTTGGCACTGTCAGCCCAGGTGGCTAGATGATAGGAGTTTAGGTTCGCCATGGGGACTTTCTTGTCTGTGTGTGGGAAAGGTGT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.10% | 4.90% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 86.00% | 14.00% | 0.07% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.00% | 2.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 76.70% | 23.20% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 87.60% | 12.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0619650681 | G -> A | LOC_Os06g33780.1 | missense_variant ; p.Gly23Glu; MODERATE | nonsynonymous_codon ; G23E | Average:46.253; most accessible tissue: Minghui63 flag leaf, score: 68.16 | benign |
0.506 |
TOLERATED | 0.42 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0619650681 | NA | 3.86E-06 | mr1071 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619650681 | 8.28E-06 | NA | mr1203 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619650681 | NA | 1.74E-06 | mr1203 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619650681 | NA | 3.00E-06 | mr1006_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619650681 | 1.06E-06 | NA | mr1037_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619650681 | 8.91E-06 | 2.31E-06 | mr1037_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619650681 | NA | 3.04E-07 | mr1062_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619650681 | 4.50E-06 | 2.11E-06 | mr1127_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619650681 | 1.60E-06 | 1.60E-06 | mr1127_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619650681 | NA | 1.39E-07 | mr1167_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619650681 | 8.70E-06 | 6.52E-07 | mr1456_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619650681 | NA | 3.95E-08 | mr1456_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619650681 | NA | 9.47E-07 | mr1565_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619650681 | NA | 9.38E-06 | mr1577_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619650681 | 4.38E-06 | 4.38E-06 | mr1608_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619650681 | NA | 1.18E-07 | mr1726_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619650681 | NA | 4.89E-06 | mr1736_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619650681 | NA | 2.79E-06 | mr1736_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619650681 | 1.50E-06 | 1.50E-06 | mr1914_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |